Notas sobre microbiología y evolución


Notas sobre microbiología y evolución

ALEJANDRO MELO FLORIÁN M.D.
Especialista en Medicina Interna
Bogotá D.C. – Colombia


Nosotros subscribimos Los Principios del código HONcode de la Fundación Salud en la RedNosotros subscribimos los Principios del código HONcode.
Compruébelo aquí.

Otras publicaciones sobre Microbiología clínica e Infectología por Alejandro Melo-Florián MD

La evolución  de las células primitivas

Perspectiva histórica

    Antes de entrar de lleno en el contenido de este tema, es importante conocer un poco acerca de los antecedentes históricos sobre la evolución. Varias centurias antes de Charles Darwin, la escuela de filosofía giega fundada por Anaximandro (611-547 adC) que históricamente está conectada con los escritos del filósofo y poeta latino Lucrecio, ya había admitido una teoría atómica y una teoría de la evolución, cuya semejanza con los conceptos actuales es sorprendente.El científico francés Georges Louis Leclerc de Buffon (1707-1788)

George Luis Leclerc, Conde de Buffon
1707 – 1788
Naturalista, matemático y cosmólogo. 

estuvo entre los primeros en proponer que las especies podían sufrir cambios en el transcurso del tiempo. Buffon refería como ” el mejoramiento y la degeneración son una misma cosa, dado que ambas implican una alteración en la constitucion original“.Esta hipótesis de Buffon, aunque algo vaga, intentaba explicar la desconcertante variedad de las criaturas en el mundo moderno.

La historia de la vida se ha venido reconstruyendo gracias al estudio de los fósiles conservados en las rocas sedimentarias. El agrimensor inglés William Smith (1769-1839), fué de los primeros en observar que había diferentes capas de rocas, con diferentes fósiles en cada una de ellas. En el transcurso de sus diferentes viajes por Inglaterra llegó a notar como cada estrato, independientemente del lugar de Inglaterra en que se hallara, contenía tipos característicos de fósiles y como estos mismos fósiles permitían identificar estratos particulares. Aunque Smith no interpretó sus hallazgos, se dió el inicio de una revolución en los ámbitos de la geología y la biología: la ciencia de la Tierra se estaba transformando en un estudio del tiempo y del cambio a través de las eras, en lugar de un simple catalogar de rocas.

Uno de los límites más tajantes en el registro de las rocas es el que separa el período Cámbrico de los anteriores. Los 11 períodos de tiempo posteriores a la era Cámbrica se conocen como período fanerozoico [1] (del griego: era de la vida manifiesta). Uno de los grandes acontecimientos de la era Cámbrica fué el desarrollo del aparato bioquímico de la fotosíntesis que permitió la liberación y acumulación del oxígeno, fenómeno de determinó un nuevo ciclo de la adaptación biológica.

Trilobites fosilizados del Cámbrico
Los primeros organismos que evolucionaron en respuesta a este cambio ambiental fueron capaces de tolerar el oxígeno. Posteriormente las células consiguieron el empleo activo del oxígeno en su metabolismo para obtener mayor energía a partir de los sustratos alimenticios. En general, se considera que las bacterias anaerobias surgieron en la Tierra hace aproximadamente 3500 millones de años, las bacterias anaerobias fotosintéticas surgieron aproximadamente hace 3000 millones de años, y las cianobacterias fotosintetizadoras en el período de 2500 a 2000 millones de años. La aparición de los procesos de fotosíntesis aeróbica hace alrededor de 3000 millones de años, ha sido posible gracias a la datación en estromatolitos fósiles, siendo de 3000 millones de años en aquellos más antigüos.

    De acuerdo a los cálculos de Lloyd V. Berkner y de Lauriston C Marshall, investigadores del Graduate Research Center of the Southwest en Dallas, cuando el oxígeno atmosférico llegó a concentraciones del 1%, hubo sustrato en cantidades suficientes para la elaboración de ozono que proveyó un filtro para la lesiva radiación UV, de modo que el fitoplancton pudo sobrevivir en la superficie soleada superior de los oceános primitivos. Como resultado del posterior crecimiento exponencial de esta población celular, hubo tal aumento de la fotosíntesis, que al mismo tiempo que produjo un secuestro masivo de carbono, liberó una gran cantidad de oxígeno a la atmósfera [2].

Atmósfera  

    Durante la mayor parte del período pre-Cámbrico la Tierra estuvo habitada por microorganismos relativamente simples, muchos de ellos comparables en estructura y complejidad a las modernas bacterias, con mecanismos de evolución comparativamente semejantes. Las variaciones genéticas hicieron posibles mejores mecanismos de adaptación para supervivencia y reproducción en un determinado ambiente, de tal forma que los caracteres de estos organismos mejor adaptados estuvieron presentes con mayor frecuencia en las poblaciones descendientes.

    La subsecuente aparición de nuevas formas de vida a través de este principio de selección natural determinó a su vez grandes variaciones en el ambiente físico, alterando en consecuencia, el escenario físico de la evolución. Estos mejores mecanismos de adaptación fueron la inclusión del material genético dentro de un núcleo aislado y rodeado por una membrana. Este nuevo tipo de célula nucleada se organizaron mucho mejor que aquellas que carecían de núcleo y fueron capaces de una reproducción celular más avanzada, en el sentido que las variaciones genéticas de los padres podían ser transmitidos a su progenie.

En la actualidad se considera que las formas de vida actuales de mayor semejanza a las fósiles, son los clostridios.


[1] Se considera que el fanerozoico corresponde al tiempo durante el cual se hallan los registros fósiles de los organismos vivientes en el registro geológico. Comprende las tres épocas geológicas de Paleozoico, Mesozoico y Cenozoico. [2] Cloud P, Gibor A: The oxygen cycle. Scientific American 1970; 223(3): 110-123

Importancia de los restos fósiles en el estudio microbiológico

Los restos fósiles de los microorganismos permiten reconocer características principales como el tamaño, la forma y el grado de complejidad morfológica, que a veces incluso, permiten el reconocimiento de detalles ultraestructurales. Pero las huellas de la evolución de  la citopaleontología del pre-Cámbrico no solamente pueden ser seguidas por las huellas del registro fósil, sino también por la información relevante al metabolismo y aspectos bioquímicos de las células actuales.Existe una serie de pruebas que orienta hacia la relativa complejidad de la estructura de un fósil microscópico: la existencia por ejemplo de filamentos ramificados, la forma de tipo “de botella”, la presencia de cuerpo densos en el citoplasma, la configuración de tipo tetrahédrico en las células que podría atribuírse bien a mitosis o a meiosis. Igualmente la existencia de filamentos muy ramificados, que algunas veces pueden semejar a ciertas algas eucarióticas verdes, la presencia de microfósiles esferoidales con aspecto de paredes dobles. Los fósiles más primitivos de estructura afín a la de los procariotas datan de aproximadamente 1.500 millones de años; aunque en los sedimentos más antiguos se han descubierto diferentes tipos de arqueobacterias, aún no permiten una identificación convincente de células eucarióticas.

Célula procariótica

Al realizar medidas sistemáticas del tamaño de las células, se ha encontrado que en las rocas de ~1450 millones de años no se observan células mayores a los 100 micrómetros de diámetro. Las células de tamaño superior a los 60 micrómetros en general han sido encontradas en rocas con datación de equivalente a los 1400 millones de años. Las especies correspondientes son algas, que se postula que flotaban libremente en lugar de formar mallas, por lo cual se suelen encontrar en las denominadas lutitas, que son los restos sedimentarios de las aguas profundas. El mayor tamaño descrito en las células procarióticas es de aproximadamente 600 micrómetros de diámetro, en restos fosilíferos de con antiguedad de ~1400 millones de años. Los estudios morfológicos muestran como hay una interrupción en los registros fósiles durante el período de 1400 a 1500 millones de años.

Variabilidad genética

En

los 138 años transcurridos desde la publicación de “On the origin of species” acaecido el 24 de Noviembre de 1859, los principios básicos de Darwin se han ido refinando en forma progresiva. Según Darwin, la evolución consiste en la existencia de modificaciones aleatorias y heredables en los individuos de una población. La selección natural -entendida como la supervivencia y la reproducción diferencial de los individuos genética distintos de una población- adopta las modificaciones beneficiosas y tiende a rechazar las perjudiciales. De este modo, la selección natural implica una mezcla, tanto de variabilidad como de selecccion, de azar como de necesidad.

Charles Darwin y la evolución

Vídeo extraído del programa de televisión de Eduard Punset “Redes”.  
Cuando en 1844 Darwin expandió su monografía original de treinta páginas  “On the origin of species” hasta su publicación definitiva el 24 de noviembre de 1859, expresó “según nuestra teoría, no hay obviamente poderes que tiendan a exaltar constantemente las especies excepto la lucha mutua entre los diferentes individuos y las clases (…) y negó la inmutabilidad de las especies, del mismo modo que Alfred Russell Wallace al describir los resultados sobre la variabilidad geográfica de diferentes especies en la Amazonia y Borneo.
Alfred Russel Wallace
Monmouth, 1823 – Broadstone, 1913
Crédito de imagen:
quintadelmochuelo.blogspot.com

    Al considerar los mecanismos evolutivos actuales sin diferencia con los que actuaron en otras épocas, los estudios en los tiempos actuales son válidos para el conocimiento del proceso evolutivo. El proceso evolutivo tiene dos grandes vertientes, la evolución filética y el surgimiento de nuevas especies.

En virtud de la primera, se acumula una gran cantidad de cambios en una sola línea de descendencia, que permiten una mejor adaptación al ambiente y por la segunda, en las líneas de la descendencia surgen otras nuevas.

Darwin refirió al tratar sobre el  tema de la aparición de grupos de especies vinculadas,

 (…) que debe haber sido un proceso extremadamente lento; y que los progenitores tienen que haber vivido largo tiempo antes que sus descendientes modificados (…) Esos intervalos habrán dado tiempo para que se multiplicaran especies de alguna forma madre: y en la formación geológica siguiente, esos grupos o especies apracerán como creados de pronto (…) podría necesitarse una larga sucesión de edades para adaptar un organismo a alguna nueva y peculiar forma de vida, pero cuando esa adaptación se hubiera cumplido y unas cuantas especies hubieran adquirido ventaja sobre otros organismos, seria necesario un tiempo relativamente corto para producir muchas formas divergentes que rápidamente se extenderían por todo el mundo  “.

La evolución, además de los cambios provocados en la estructura de los genes por mutación, produce adicionalmente cambios en la cantidad y la organización de estos. Las fuerzas que operan las mutaciones génicas operan aleatoriamente, en el sentido de que se producen independeientemente de sus resultados con la adaptabilidad resultante al medio ambiente. Los sujetos o individuos mutantes no tienen mayor probabilidad de aparecer en un ambiente que lo favorezca que en otro ambiente que lo someta a presión. En caso de aparecer un mutante favorecido, se podría considerar que presenta una pre-adaptación a un ambiente, siendo este un tipo de fenómeno adaptativo, en lugar de una respuesta adaptativa.

Charles Darwin
Crédito de imagen:

En las poblaciones con varios millones de individuos, siempre habrá altas probabilidades de que se presenten algunas mutaciones por generación en prácticamente todos los genes de la población. Pero, de importancia, la mutaciones que originan cambios en las características  físicas del organismo tienen poca probabilidad de ser ventajosas, debido a que las poblaciones se hallan por  lo general bien adaptadas al medio ambiente y los cambios importantes suelen ser poco adaptativos. La mayoría de los cambios evolutivos se producen por acumulación gradual de mutaciones ínfimas, acompañadas por transiciones lentas en las características físicas de los individuos de una población.

Un gen en un locus determinado puede presentar formas variantes denominadas alelos. En una población grande pueden existir varios alelos en un locus, aunque solo puede haber dos en un individuo. Cada alelo surge por la mutación de un gen pre-existente y puede diferir del mismo en una o varias partes de la secuencia de nucleótidos.

 Gen en locus
Crédito de imagen:
La variabilidad hereditaria, reflejada en la existencia de múltiples alelos en una población, es uno de los prerrequisitos de importancia para el cambio evolutivo. Si existen por ejemplo, dos o más alelos en una población, la frecuencia de presentación de un alelo puede aumentar a expensas del otro o de los otros, a consecuencia de la selección natural. Y aunque el valor de adaptación de un alelo dado no se encuentra determinado, la contingencia de los cambios ambientales hace que en aquellas poblaciones con gran cantidad de variabilidad genética la protección frente a eventuales cambios sea mayor.
Se han desarrollado una serie de experimentos que demuestran que a  mayor variabilidad genética de una población, mayor es su tasa de evolución. La “cantidad” de la variabilidad existente en una población es importante para el biólogo porque determina la plasticidad evolutiva de esa especie. Una de las técnicas que ha permitido la mejor cuantificación de la variabilidad en las poblaciones naturales ha sido la de la electroforesis de proteínas.
Las proteínas elaboradas por diferentes individuos se comparan mientras se hacen correr por el gel durante un intervalo determinado de tiempo; una vez las proteínas han migrado, se determina la posición de las mismas. Generalmente  se examinan alrededor de unos 20 loci, para tener una mejor medida de la variabilidad de las poblaciones naturales. en el reino animal, los invertebrados presentan mayor variabilidad genética al ser comparados con los vertebrados. en los invertebrados el promedio de la heterocigosis es del 13.4 %, mientras que en los vertebrados es del 6.6 %. La variabilidad observada en diferentes poblaciones suele ser superior a lo esperado: los individuos suelen ser heterocigóticos para una característica en el mayor porcentaje de los casos, lo cual tiene importancia capital en la reproducción sexual. La recombinación de los genes que tiene lugar durante la meiosis que egendra nuevas combinaciones de alelos en el mismo cromosoma junto con la distribución aleatoria de los cromosomas en las células germinales no altera por sí sola las frecuencias génicas, ni provoca evolución de ningún tipo.
Este efecto es el denominado equilibrio de Hardy – Weimberg, debido a sus descubridores, el matemático GH Hardy, y el biólogo W. Weimberg, quienes demostraron que la recombinación y la distribución aleatoria no provocan cambios netos en los alelos de una población. En ausencia de selección, las frecuencias génicas se mantendrán constantes de una generación a otra.  El efecto de la recombinación y de la distribución aleatoria solamente reordena los genes existentes en una población dada, de modo que en cada generación se expongan nuevas combinaciones de alelos a la selección natural.
GH Hardy y W Weimberg
    La reproducción sexual genera por lo tanto, una enorme diversidad genética, que incrementa mucho las posibilidades de evolución y representa para la especie una adaptabilidad muy grande ante eventuales modificaciones en el medio ambiente. Quizá esta sea la razón de que la sexualidad tenga tan amplia difusión en el mundo de los seres vivos, exceptuando las bacterias, que con sus elevadas tasas de reproducción pueden incorporar mutaciones en períodos cortos de tiempo.
Las poblaciones almacenan un gran número de alelos, aún cuando no sean adaptativos, con el fin de tener una reserva de adaptabilidad en caso de súbitos cambios en el medio ambiente. La forma en que las poblaciones mantienen estos depósitos de variabilidad genética es por la activación de mecanismos que mantengan la diversidad, a pesar de que haya fuerzas selectivas que tiendan a eliminarla. El problema del lastre genético ha surgido por razón de la enorme variabilidad de las poblaciones. El lastre genético explica como la persistencia de alelos con menor eficacia, por la superioridad de los rasgos heterocigóticos.

El proceso de la evolución se considera como con dos dimensiones principales: la evolución filética y la especiación. La evolución filética consiste en que los cambios graduales que se producen con el tiempo en una sola línea de descendencia y estos cambios originan una gran diversidad en el mundo de los seres vivos.


El gradualismo filogenético

Desde

  Darwin, se ha considerado como la especie juega un papel crucial en la evolución. La especie es un conjunto de individuos aislados desde el punto de vista reproductivo de otras especies, con un criterio de fertilidad. Otras especies pueden habitar el mismo terreno geográfico, lo cual se denomina coexistencia simpátrica, pero no existe ninguna vinculación reproductiva. Ernst Mayr ha referido como “la especie es un sistema genético finamente integrado que ha sido seleccionado a través d emuchas generaciones para adaptarse a un nicho[1] definido en su entorno“.

El biólogo Ernst Walter Mayr
1904 – 2005
“Darwin del siglo XX”
Crédito de imagen:

Desde la perspectiva darwiniana, los hallazgos fósiles sugerían que las nuevas especies surgían por trasnformación muy lenta de la población ancestral, proceso en el cual tomaban parte una gran población de individuos, proceso que Niles Eldredge y Stephen Gould denominaron gradualismo filogenético. Pero volviendo nuevamente a la evidencia fósil, esta no concuerda con la evolución gradual, por la escasez de los restos fósiles a favor de tal evidencia. Lo que muestran los hallazgos fósiles es una historia brusca de rupturas y saltos en el proceso evolutivo.

La biología ofrece una diversidad de poblaciones de individuos caracterizados por la individualidad. Cualquier población esta compuesta de individuos únicos y distintos y, desde un punto de vista poblacional, solo tienen relevancia las variaciones individuales. Pero desde el punto de vista genético, la importancia de la población es que provee un acervo de variaciones o un acervo génico,concepto en el cual se intersecta la posibilidad de la evolución gradual. En la actualidad se considera que los procesos de evolución gradual son suficientemente capaces para explicar el surgimiento de nuevas especies y nuevos tipos y el origen de innovaciones evolutivas, como las alas en las aves, por citar alguno.

    Actualmente se acepta que la diversidad genética de una especie se transmite a sus sucesores en virtud de la herencia, en virtud de mecanismos genéticos que abarcan las mutaciones, recombinaciones, sustituciones y otra vasta gama. Estos mecanismos genéticos se regulan colectivamente por un proceso denominado flujo genético, que hace referencia a los movimientos de inmigración o emigración de alelos en una población.
 El palentólogo Niles Eldredge
Crédito de imagen:
    Si se tiene en cuenta la emigración y la inmigración de alelos, se está dando lugar a un lento proceso de sustitución alélica dirigida por la selección natural, lo cual es un mecanismo para el surgimiento de nuevas especies a la luz del gradualismo filogenético ( artículo de Stephen Gould: gradualismo filogenético ) . Este concepto global se conoce como continuidad simpátrica. Aplicado al surgimiento de nuevas especies, el flujo genético tiene mayor influencia homogenizadora en poblaciones pequeñas. El conjunto de individuos sometidos a esta influencia homogenizadora origina una especie. A menor tamaño de una población aislada geográficamente, mayores los efectos.
Stephen Jay Gould (by Kathy Chapman)
Crédito de imagen:
Este modelo de la emigración alélica de una gran población a una menor población está de acuerdo con el gradualismo filogenético. El desarrollo de una nueva especie de acuerdo a Eldredge y Gould se presenta con mayor probabilidad en poblaciones aisladas geográficamente.
Esta poblaciones aisladas localmente se denominanpoblaciones aisladas periféricas que dan origen  a una nueva especie si los mecanismos de aislamiento actúan de tal forma que impidan la reiniciación del flujo genético. Como una consecuencia de la teoría de laespeciación alopátrica, en las poblaciones aisladas periféricas: surgen nuevas especies y consecuentemente, los fósiles de las nuevas especies no se hallan en los terrenos geográficos de sus ancestros. Si se encuentran nuevamente la especie original y la surgida de novo, aunque compartan el mismo territorio geográfico, no habrá endogamia entre ellas, lo cual se conoce comocoexistencia simpátrica. (glosario en página 3 del hipervínculo coexistencia simpátrica)

Volviendo nuevamente al gradualismo filogenético, éste depende de mutaciones génicas unitarias, que en la medida de ser adaptativas y permitir una mejor adaptación de ese conjunto de organismos portadores de tal genoma, se acumularán sucesivamente. Teniendo en cuenta el flujo de genes o flujo genético, el surgimiento de especies depende de la regulación y reordenación génicas que producen nuevos genes en el gradualismo filogenético. Los cambios fenotípicos importantes en una especie dada se presentan cuando hay cambios en los genes reguladores[2].

    En contraste con el lento y sucesivo acúmulo de variaciones del gradualismo filogenético, ocasionalmente actuarán mecanismos desencadenados por sucesos catastróficos, contingentes, que ocasionarán reorganizaciones forzadas e inusuales de tales genes reguladores que igualmente, y de acuerdo a Carson, permitirían el proceso de especiación. Este concepto de cambios contingentes, de acuerdo con la teoría saltatoria propugnada por biólogos como Hugo de Vries, explica como las mutaciones aludidas como “mutaciones sistémicas” explican el origen de especies superiores. Con respecto a este “saltacionismo”, Gould lo incorpora conceptualmente al gradualismo filogenético al considerarlo como operante, pero no adaptativo, como ocurre en el gradualismo filogenético clásico, en el cual la selección natural controla las mutaciones puntuales aleatorias.


[1] El nicho, considerado en referencia a nicho ecológico, hace referencia a la manera en la cual un organismo establece interacciones con todos los factores bióticos y abióticos de su ambiente. Comprende una descripción de las funciones y asociaciones de una especie determinada en la comunidad de la cual forma parte[2] A favor de estos cambios en los genes reguladores se encuantra la evidencia de las variantes de diferentes enzimas encontradas en una amplia muestra de individuos, lo cual sugiere un enorme grado de variabilidad alélica. Se desconoce el grado de esta variabilidad que corresponda al denominado “ruido” evolutivo y cual depende de la selección natural.

Universalidad del código genético 

En

las décadas transcurridas desde el genial desciframiento del código genético, se ha examinado el ADN y las proteínas de muchas especies, encontrándose con la evidencia que desde los microorganismos más sencillos como Escherichia coli  hasta los más complejos, como Homo sapiens sapiens, el código genético es universal. Evolucionó tempranamente, permaneció relativamente constante y determina la unidad fundamental de todos los seres vivos. La única excepción al código genético de las células eucarióticas y de las procarióticas ocurre con los mitocondrios, porque estos orgánulos contienen su propio ADN, transcriben sus propias moléculas de ARNm ARNt y ARNr y hacen su propia síntesis de proteínas.

ADN
Crédito de imagen:
http://colin-laotramirada.blogspot.com/2009_09_01_archive.html

    La información genética está codificada en la secuencia de nucleótidos de las moléculas de ADN y éstas a su vez determinan la secuencia de aminoácidos en las moléculas de las proteínas. Beadle y Tatum realizaron experimentos en los cuales demostraron como los genes influenciaban la producción específica de proteínas, de los cuales surgió el principio de “un gen-una enzima”, corregido posteriormente a “un gen-un polipéptido”. El estudio de la hemoglobina falciforme demostró como el cambio en un solo aminoácido de una cadena polipeptídica cambiaba la función de la proteína resultante.

La genética molecular de los virus y los procariotas

M
uchos de los avances en los conocimientos en la genética molecular fueron dados a partir de los experimentos con células procarióticas y virus. Las investigaciones con neumococos,Escherichia coli y bacteriófagos permitieron conocer en mayor profundidad la fisiología del ADN y los detalles sobre su transcripción y traducción. Los biólogos están ahora capacitados en esta tecnología recombinante del ADN para la manipulación de los genes en procesos de modificación y recombinación de fragmentos del ADN en una forma antes no imaginada, para la inserción de estas moléculas modificadas en células donde son activas. El análisis de fragmentos de diferentes tamaños sobre la base del polimorfismo de los organismos, es utilizado en la investigación epidemiológica y en el establecimiento de relaciones filogenéticas. Waterhouse y colaboradores [1993] emplearon sondas de “fingerprinting” para la identificación de procariotes, mientras Versalovic y colaboradores [1995] establecieron por “fingerprinting” las relaciones filogenéticas y la resistencia bacteriana delStreptococcus pneumoniae.

Video sobre células procarióticas

El avance en el conocimiento de la biología molecular ha permitido el desarrollo de un conjunto de técnicas que  posibilitan  la manipulación del material hereditario. Una vez que Watson y Crick descubrieron la estructura molecular del material genético se comenzó a entender cual era la base física de la herencia, la composición de los genes, la forma como se traducía  la información, y de que manera se sintetizaba una proteína. Posteriormente el descubrimiento de las enzimas de restricción permitió al investigador manipular los genes, pues las enzimas de restricción funcionan como “tijeras moleculares”, cortando el ADN en segmentos específicos. Los trabajos de Emil Southern permitieron ubicar un gen entre miles dentro del ADN de un ser vivo. Posteriormente el descubrimiento de la Reacción en Cadena de la Polimerasa [PCR de la sigla inglesa Polymerase Chain Reaction] avance técnico derivado del conocimiento de la replicación del ADN masificó el uso de las técnicas de análisis del ADN.

Tradicionalmente, los microbiólogos han hecho los diagnósticos mediante el aislamiento e identificación de los microorganismos, pero estos métodos convencionales se basan en el cultivo en diferentes medios para el aislamiento de los microorganismos y en una serie de pruebas bioquímicas e inmunológicas para su correcta identificación. Las limitaciones tradicionales han sido la baja sensibilidad de los cultivos y el requerimiento de microorganismos viables. Para resolver esto se han desarrollado métodos inmunoenzimáticos para la identificación precoz de los agentes patógenos, lo que ha permitido que laboratorios relativamente sencillos puedan identificar microorganismos de una forma precoz.

Con el advenimiento de técnicas sencillas de biología molecular hoy disponibles en los laboratorios microbiológicos, se logra el reconocimiento de moléculas de ADN y ARN pertenecientes a los diferentes microorganismos. La ventaja de estas técnicas es que permiten identificar precozmente los microorganismos que luego se confirmarán en el aislamiento y además, identifican microorganismos sin viabilidad.

Debido a su rapidez, su alta sensibilidad y especificidad, estas técnicas han desplazado paulatinamente los métodos microbiológicos tradicionales, al punto que por ejemplo, en EE.UU. se calcula que en un futuro muy cercano una gran mayoría de las pruebas diagnósticas microbiológicas serán llevadas a cabo por métodos moleculares, complementando de esta manera las pruebas inmunoenzimáticas o serológicas y las bioquímicas.

Diversidad de los procariotas

Definición de las células procarióticas, de las eucarióticas y de los organismos acelulares.

Los

 procariotas pertenecen al reino Monera y junto con el reino Protista (los eucariotas unicelulares y algunos eucariotas multicelulares simples) y Fungi, constituyen importantes agentes de enfermedades no solo para el hombre, sino para las plantas y animales de los que estos dependan. Todos estos organismos han sido estudiados convencionalmente por la microbiología. Aunque los virus son causantes de enfermedad no se consideran organismos vivos y no se clasifican en ningún reino, son también estudiados por la microbiología.

Desde el punto de vista evolutivo, los procariotas son el grupo más antiguo de organismos sobre la Tierra; a pesar de su simplicidad estos organismos son los más abundantes del mundo, de ellos se conocen aproximadamente unas 2.700 especies distintas. Los procariotas son los organismos celulares más pequeños y en un gramo de suelo fértil puede haber hasta 2.500 millones de individuos. Los dos únicos grupos de organismos pertenecientes al reino Monera son las bacterias y las algas verde azules. Las algas verdeazules son mejor conocidas como las cianobacterias y son capaces de producir oxígeno mediante la fotosíntesis, al igual que otras algas y plantas superiores.

Las células procarióticas carecen de envoltura nuclear, cloroplastos y otros plástidos, así como mitocondrios y flagelos. Son unicelulares, aunque a veces se presentan como filamentos u otros cuerpos organizados superficialmente  de aspecto multicelular. Su modo de nutrición es predominantemente heterótrofo por absorción, aunque algunos grupos son autotróficos, bien del tipo quimiosintético o bien fotosintético. La reproducción es asexual, por fisión binaria o gemación, pero en algunos organismos pueden ocurrir intercambios genéticos mediados por plásmidos, por procesos de conjugación, transformación, transducción e intercambio de plásmidos. La movilidad en los que pueden hacerlo se realiza por medio de flagelos bacterianos o deslizamiento.

La clasificación de los procariotas no es jerárquica y los esquemas más utilizados no reflejan relaciones evolutivas. El reino Monera incluye los linajes celulares de las Archeobacteriae y deEubacteriae. Las arqueobacterias comprenden las especies de las metanógenas, las halófilas extremas y las termoacidófilas. Entre las principales eubacterias se encuentran las bacterias verdes (de tipo sulfuroso y no sulfuroso), las bacterias púrpuras (sulfurosas y no sulfurosas) las espiroquetas, las cianobacterias, y las bacterias gram-positivas, que alcanzan a llegar a las 2.700 especies.

Eficacia biológica de los procariotas

Las
células procarióticas desarrollaron con  el transcurso del tiempo una serie de procesos para utilizar al máximo los nutrientes necesarios para el crecimiento celular. Si se atribuye el objetivo de una célula bacteriana como crecer y multiplicarse tan rapido como sea posible,Escherichia coli es un paradigma del éxito en este sentido, pues logra duplicar su población cada 20 minutos. Dentro de los procariotas, y en especial Escherichia coli,la versatilidad en el uso de nutrientes ambientales es una de las razones para este fitness (mejor traducido como eficacia biológica), en razón a su armamentario enzimático, con un acervo de ~1700 diferentes enzimas  y a su eficiencia en sus actividades sintéticas, porque no fabrica todas las proteínas a un mismo tiempo, sino solamente aquellas que son estrictamente necesarias y en las cantidades justas [1].
Escherichia coli es el procariota mejor conocido, el cual creciendo en condiciones óptimas puede duplicar su población cada 20 minutos. Las células procarióticas pueden sobrevivir en ambientes que no soportan otras formas de vida como en las extensiones heladas de la Antártida, en las zonas abisales del océano y en las aguas hirvientes de las aguas termales. Algunos procariotas pueden sobrevivir sin oxígeno libre obteniendo su energía a partir de anaerobiosis. Esta afirmación lleva evolutivamente a postular que los procariotas debieron haber disfrutado del predominio exclusivo sobre el planeta tierra durante los períodos geológicos de anaerobiosis desde hace 1.500 hasta hace unos 800 millones de años. Esto también viene corroborado por la naturaleza anaeróbica de la fotosíntesis bacteriana que en sí misma conlleva una paradoja: los organismos fotosintéticos prosperan cuando la luz es abundante, pero estos ambientes son también en general los que tienen mayores concentraciones de oxígeno el cual es tóxico para la fotosíntesis bacteriana. Estas necesidades contradictorias se pueden explicar si se asume que la fotosíntesis anaeróbica evolucionó en las bacterias primitivas a principios del precámbrico, cuando la atmósfera era esencialmente anóxica. Por tanto, los fotosintetizadores debieron haber vivido en comunidades en forma de mallas, en aguas poco profundas y expuestas a plena luz solar [1].
Aspecto de estromatolito 
fotografía del autor
    Algo más tarde las células procarióticas dieron lugar a los primeros organismos capaces de la fotosíntesis aeróbica, los precursores de las modernas cianobacterias. Para las bacterias fotosintéticas anaeróbicas, el oxígeno molecular liberado por estas cepas mutantes era una toxina y el resultado fué que los fotosintetizadores aeróbicos pudieron suplantar a aquellos anaeróbicos en las partes superiores de aquellas comunidades en malla.
Las especies anaeróbicas se adaptaron a las partes inferiores de las mallas (hablando en términos de estromatolitos) donde hay menos luz y menos concentración de oxígeno. Muchas bacterias fotosintéticas ocupan hoy esos hábitats.

[1] Los estromatolitos (del griego estroma: cubrecama y litho: piedra) fueron descritas a comienzos del siglo XX, en forma de masas calizas finamente estratificadas, descritas por Charles Walcott en los estratos precámbricos del oeste estadounidense. Walcott interpretó los estromatolitos como arrecifes fosilizados que se habrían formado probablemente con varios tipos de algas. El análisis de los microfósiles contenidos  Los estromatolitos fósiles presentan típicamente el aspecto de montículos o columnas formadas por múltiples capas finas, amontonadas unas sobre otras. Los estromatolitos están constituídos por comunidades de cianobacterias y otros procariotas en aguas poco profundas, siendo cada  capa una fase en el crecimiento de las comunidad. Los estromatolitos se formaron en la mayor parte de la era precámbrica contenidos en estas estructuras demuestra que las paredes celulares se han petrificado en forma tridimensional y se han convertido en una importante fuente de documentación sobre la historia primitiva de la vida.

El cromosoma de Escherichia coli

    El cromosoma de Escherichia coli es una sola hebra continua y circular de ADN de doble cadena de aprox. 1 mm de longitud cuando está completamente extendido, con un grosor de 2 nm de diámetro, cuyo contenido es de aprox. 4.7 millones de pares de bases.

Escherichia coli
Crédito de imagen:

Dentro de la célula, el cromosoma está compactado en un cuerpo de configuración irregular, conocido como nucleoide. La replicación es bidireccional, suele comenzar en una secuencia específica de nucleótidos y a medida que la horquilla de replicación se aleja en direcciones opuestas, la polimerasa de ADN añade los nucleótidos  a los extremos 3′ de las cadenas adelantadas y a los fragmentos de Okazaki de las cadenas retrasadas, con lo cual toda esta estructura en replicación toma el aspecto de la letra griega theta, de modo que esta replicación se conoce comoreplicación theta.

La transcripción tanto de Escherichia coli como de otras células procarióticas ocurre por la síntesis de una molécula de ARNm a lo largo de una cadena molde de ADN. El proceso se inicia cuando a una secuencia de nucleótidos conocida como promotor se le une la polimerasa de ARN haciendo que la doble hélice se abra, dando inicio a la transcripción. La cadena del nuevo ARN permanece unidad a la cadena madre de ADN por puentes de hidrógeno -en un momento dado solamente están unidos 10 o máximo 12 nucleótidos a la cadena de ADN- hasta que posteriormente se despega como una cadena simple.

Todos aquellos conjuntos de nucleótidos en las cadenas de ADN encargados de codificar la síntesis de proteínas u otros polipéptidos constituyen los llamados genes estructurales. Generalmente los genes estructurales que codifican las síntesis de polipéptidos con funciones relacionadas se presentan juntos, formando secuencias en el cromosoma bacteriano. Los grupos de tales genes suelen transcribirse en una sola cadena de ARNm, de modo que la célula puede disponer rápidamente de los substratos requeridos. La molécula de ARN tiene una secuencia guía en su extremo 5′, la cual ayuda a unir el ARNm al ribosoma. La secuencia adicional de nucleótidos en el estremo 3′ se conoce como la “cola”.

Estructura y Función de los ácidos nucleicos

A nivel celular la información sobre la cantidad y tipo de proteínas a sintetizar está dada por los ácidos nucleicos ADN [Acido Desoxirribonucleico]  y ARN [Acido Ribonucleico]. Tanto el ADN como el ARN están formados por cuatro monómeros diferentes llamados nucleótidos. Cada nucleótido comprende un grupo fosfato, una pentosa (molécula de azúcar de 5 carbonos) y una base orgánica. En el ARN la pentosa es la ribosa, mientras que en el ADN es la desoxirribosa.

Otras diferencias entre los monómeros de ADN y de ARN están en una de sus bases; ellas son de dos tipos en los ácidos nucleicos: purinas y pirimidinas. Estructuralmente las purinas se forman de la fusión de un par de anillos, mientras que las pirimidinas sólo tienen un anillo. Ambas son heterocíclicas, lo que significa que los anillos están constituidos átomos diferentes a los de carbono, en este caso, nitrógeno además de carbono. Los átomos de nitrógeno dan a estas moléculas su carácter básico, pero ninguna está protonada (ionizada) a pH neutro. El carácter ácido de los nucleótidos es debido a la presencia del fosfato que se disocia liberando iones hidrógeno en condiciones fisiológicas. Los nombres de las bases son: Adenina, Guanina y Citosina (que se encuentran en el ADN y ARN); Timina (que solo se encuentra en el ADN) y el Uracilo (que solo se encuentra en el ARN). Se simbolizan por A, G, C, T y U.

El componente glucídico [relativo en este caso, a la pentosa] de un nucleótido permite la unión entre la base y el grupo fosfato. Tanto si el azúcar es ribosa o desoxirribosa, su átomo de carbono 1’ estará unido al nitrógeno-9 de una purina o al nitrógeno-1 de una pirimidina. El grupo hidroxilo en el átomo de carbono 5’ está unido mediante un enlace éster con el grupo fosfato. Cuando los nucleótidos se unen para formar ácidos nucleicos, el grupo hidroxilo unido al carbono 3’ del azúcar de un nucleótido forman un éster con el fosfato de otro nucleótido, eliminando una molécula de agua. Así una cadena sencilla de ácido nucleico es un polímero de fosfato-pentosa (un poliéster) con bases purínicas o pirimidínicas como grupos laterales. La unión entre los nucleótidos se realiza gracias al enlace fosfodiéster.

Una cadena de ácido nucleico tiene orientación espacial, en la que el extremo 3’, tiene libre un radical hidroxilo unido al carbono 3’ del azúcar; el otro extremo, el 5’, tiene libre un radical hidroxilo o fosfato en el carbono 5’ del azúcar. La orientación de una cadena de ácido nucleico es extremadamente importante en la molécula.

ADN

El

descriframiento de su estructura molecular permitió la obtención del Nobel a los investigadores Watson y Crick. Ellos descubrieron como en su estado nativo el ADN celular está en forma de doble cadena, dispuesto en dos cadenas antiparalelas enrolladas una alrededor de la otra en forma de hélice de sentido hacia la derecha con las bases apiladas en el centro, perpendicularmente al eje de la hélice. La adenina de una cadena forma un puente de hidrógeno con la timina complementaria de la otra cadena, del mismo modo la guanina se complementa con la citosina. Esto fenómeno de la complementariedad, o la conjugación específica de una base con otra, es el fundamento de la hibridización, que permite que un segmento de ADN se enlace con su cadena complementaria. 

El calentamiento de una molécula de ADN bicatenario por encima de una temperatura crítica hace que las dos cadenas se desenrollen y se separen (proceso conocido como desnaturalización), que también se logra con exposición del ADN a pH básico o luz ultravioleta (LUV). En condiciones apropiadas la molécula puede renaturalizarse para formar la doble hélice de pares de bases nativas.

La principal función de ADN es el almacenamiento de las información hereditaria de una determinada especie, codificando la información de miles proteínas mediante secuencias de nucleótidos, que disponen el orden de los aminoácidos. El código genético de tripletas es el mecanismo que la naturaleza ha desarrollado para almacenar esta información en el ADN.


[1] En presencia de lactosa como fuente de carbonos y de energía, Escherichia coli emplea la enzima beta-galactosidasa para escindir el azúcar. Las células que crecen en un medio rico en lactosa sintetizan aproximadamente 3000 moléculas de enzima por célula. Esto en contraste con una situación “basal”, en la que sin el estímulo de la lactosa en el medio circundante, Escherichia coli solo tiene en promedio una molécula de enzima  por célula. La beta-galactosidasa es pues, una enzima inducible.

ARN

El

ARN es diferente del ADN por sus diferencias estructurales y moleculares, además las moléculas de ARN son generalmente monocatenarias, aunque puede contener una cierta cantidad de segmentos en doble hélice. La principal función del ARN en las células es la llamada traducción o paso de la información genética almacenada en el ADN a las secuencias de aminoácidos para sintetizar las proteínas. Este proceso requiere la participación de enzimas y tres tipos de ARN: el ARN mensajero (ARNm), que es una copia de la secuencia de nucleótidos del ADN; el ARN de transferencia (ARNt), que transporta los aminoácidos a los ribosomas en donde el ARNm es traducido a proteínas; y el ARN ribosómico (ARNr), cuya misión es unir el ARNm y el ARNt para que puedan llevar a cabo las reacciones de síntesis de las proteínas.

Uno de los dogmas centrales de la biología en que según el ARN surge del ADN puede ser puesto en tela de juicio si se toman en cuenta las condiciones generales de la Tierra en sus inicios. El origen de la totalidad de los organismos en el planeta se pueden rastrear hasta el denominado progenota. La evidencia de tal ancestro común viene a partir de información obtenida en el estudio del código genético. De acuerdo a la evidencia fósil hallada en células en Sudáfrica y Australia, este ancestro/progenota existió hace aproximadamente 3.500 millones de años. Los comienzos de la vida en la Tierra estuvieron sujetos a bombardeos de radiación cósmica procedente de los planetas en formación del sistema solar.

Distinción entre virus y organismos celulares

Los

organismos actualmente conocidos como virus fueron definidos inicialmente en términos operacionales, es decir, de su capacidad de ser filtrados a partir de las muestras de ciertas plantas y animales enfermos.

Hacia los finales del siglo XIX se aceptó la denominada “teoría del germen de la enfermedad”. Esta afirmación implica -traducida en los principios de la acepción de la enfermedad de nuestro tiempo-, que las enfermedades son causadas por una variedad de microorganismos existentes en la escala microscópica (los microbios) la mayoría de los cuales son cultivables. Pero había serios problemas cuando no se encontraban microorganismos en la microscopía de luz y en los organismos a los que se inoculaba una muestra en estudio desarrollaban la enfermedad. Característicamente, estas preparaciones podían pasar a a través de un ultrafiltro que retuviera aún las más pequeñas bacterias y aún conservar su capacidad infectante. 
El término virus originalmente significó “agente de enfermedad infecciosa” y debido a su capacidad de atravesar filtros fueron denominados “virus filtrables”, que luego se acortó a virus. Cuando se desarrolló la microscopía electrónica hacia la década de los 40s se visualizaron muchos virus y se conocieron muchos aspectos de su organización acelular.

Tabla 1. Diferencias entre virus y organismos celulares

                        Virus                                                               Organismos celulares

1. Compuesto de un núcleo de ácido nucleico envuelto por una cápside Unidad básica y estructuralmente de tipo celular
2. Núcleo con DNA ó RNA Tiene DNA y RNA
3. Poco contenido enzimático Abundante contenido enzimático
4. Los componentes nucleares no son capaces de autorreproducción Capaz de autorreproducción
5. Necesariamente depende de otros organismos celulares Usualmente independiente, algunas veces con dependencia de tipo facultativo, raramente dependiente
6. Localización usualmente dentro de las células de un organismo Tipo de vida usualmente libre. Aunque algunas veces se localiza dentro de otro organismo, raras veces es intracelular

Viroides

            Aún más pequeños y de mayor simplicidad -si se puede concebir- que los virus, están los viroides, los cuales son agentes aún más pequeños de enfermedad. Los viroides no tienen cápside. A pesar de su simplicidad los viroides pueden asumir el comando de las células de una planta y causar replicación autónoma amenazando la estructura del organismo.

Diferencias entre células procarióticas y eucarióticas

En

el núcleo de la célula eucariótica el ADN está organizado en cromosomas y se halla rodeado de una membrana intracelular, mientras que los procariotas solamente poseen un ADN circular simple en el citoplasma de la célula. Mientras los procariotas se reproducen asexualmente por el expedito medio de la división binaria, la reproducción asexual de las células eucarióticas tiene lugar mediante los mecanismos de la mitosis y la de tipo sexual mediante la meiosis. Las células eucarióticas suelen ser de mayor tamaño que sus semejantes procariotas, aunque los tamaños se superponen. Las células procarióticas suelen ser organismo unicelulares, mientras que las células eucarióticas son de mayor tamaño, complejidad y pluricelularidad. Un mamífero, por ejemplo puede estar formado por millones de células altamente diferenciadas tanto por estructura como por función.

La distinción entre las células procarióticas y  las células eucarióticas reside en sus diferentes procesos y estructuras nucleares, es decir, en los dominios de la cariología y la cariocinesis. El núcleo de la célula eucariótica se divide por un proceso mitótico  bien definido, con la participación de una serie de elementos celulares definidos. El nucleoide de la célula procariótica no requiere todo el armamentario celular formal de la mitosis.

La filogenia en el reino Monera indica que sus miembros tienen propiedades fisiológicas diversas. Pero con todo y su diversidad, la citología es sencilla, por la ausencia de muchos de los organelos de las células eucarióticas. Es posible que la ausencia de los organitos citoplasmáticos tenga relación con el pequeño tamaño de las células procarióticas.

A pesar de su aparente simplicidad, las células procarióticas poseen una variedad de organitos celulares especializados, que muestran un grado alto de organización, con un significado funcional aún desconocido.

El objeto de la citología bacteriana es la descripción de la organización ultraestructural de tales organitos, independientemente de su significado funcional.

Tradicionalmente, la falta de tal conocimiento sobre el significado funcional ha promovido la idea de que las bacterias son estructuras primitivas, pero es posible que surjan conocimientos sobre los equivalentes funcionales de tales organitos a partir de organismos filogenéticamente más evolucionados.

Hábitats de las células procarióticas

Ecosistemas, hábitats y nichos ecológicos

Las poblaciones están constituídas por organismos individuales, mientras que las comunidades están constituídas por poblaciones. Desde el punto de vista ecológico, una comunidad comprende a todas las poblaciones de organismos que habitan un ambiente común y se encuentran en interacción recíproca. Buena parte de estas interacciones entrarán  a formar parte del proceso de selección natural por las influencias que ejercerán sobre cada individuo y sobre las especies existentes en la comunidad.

Las interacciones entre las diferentes poblaciones son variadas, pero pueden describirse en general como de tipo competitivo, depredador y simbiótico.

Competencia

La competencia es la interacción entre los individuos de la misma especie (competencia intraespecífica) o entre individuos de especies diferentes (competencia interespecífica) que utilizan los mismos recursos o substratos, que generalmente tienden a existir en cantidades limitadas. Una de las consecuencias de la competencia es la disminución o la limitación del fitness, entendido como eficiencia biológica para dejar mayor progenie. La competencia que implica una interacción frente a frente, una lucha abierta, se denomina competencia por interferencia. La competencia tiende a ser mayor entre aquellos organismos cuyos requerimientos y estilos de vida son similares.

En 1934 el biólogo ruso GF Gause formuló el principio de la exclusión competitiva. Según este principio cuando dos especies compiten por el mismo recurso limitado  una especie u otra tendrá mayor eficiencia en el control del acceso a este recurso, finalmente eliminando a la especie competidora en situaciones en que estén juntas. Sin embargo, el principio de exclusión competitiva de Gause conduciría a pensar que, en cierto modo solo tienden a coexistir especies con afinidades por recursos diferentes. Pero es frecuente encontrar que hay especies ecológicamente similares coexistiendo en la misma comunidad, planteando el grado de similitud o afinidad por el uso de un recurso, de modo que el principio de exclusión competitiva no conlleve necesariamente la desaparición de otras especies. De estas bases surgió el principio del nicho ecológico, el cual puede ser definido como la “profesión” de un organismo dado si se acepta que “hábitat” es el domicilio. Un nicho ecológico se puede definir como el ambiente total y el modo de vida de todos los miembros de una especie particular en una comunidad.. Los nichos incluyen factores físicos como luz y temperatura, requerimientos de humedad, aspectos del comportamiento del organismo, como patrones de movimiento, ciclos de actividad, etc.

Crecimiento bacteriano

En cualquier sistema biológico el crecimiento puede ser definido como el incremento ordenado de los compuestos químicos. El incremento de la masa puede no reflejar realmente el crecimiento debido a que las células pueden aumentar el contenido de productos de depósito, por ejemplo poli-ß-hidroxibutirato. En un medio adecuado en el cual la bacteria se encuentre completamente adaptada , se habla de un crecimiento balanceado. Durante el período de crecimiento balanceado la duplicación de la biomasa se acompaña de duplicación de proteínas, ARN, ADN y agua intracelular. Es decir, se aumenta la masa con la conservación de las características químicas. En el crecimiento balanceado la medición  de cualquier componente es suficiente para la determinación de la tasa de crecimiento.

Efecto de la concentración de nutrientes en la tasa de crecimiento

En muchos aspectos, los procesos de crecimiento bacteriano pueden ser ligados a la serie de reacciones químicas en las cuales los componentes del medio o reactantes facilitan la producción de más células. La velocidad de las reacciones químicas normalmente está determinada por la concentración de los reactantes, pero como un fenómeno paradójico la tasa de crecimiento bacteriano permanece constante hasta que el medio está prácticamente exhausto del reactante. Esta paradoja se explica por la presencia de permeasas que permiten que las concentraciones intracelulares de nutrientes estén en el nivel de saturación necesario para el crecimiento, lo cual es una característica adaptativa ante un medio con concentraciones variables de reactantes nutrientes, por ejemplo, que estén muy diluídos. Sin embargo, cuando las concentraciones de los nutrientes en el medio ambiente son muy bajas, las permeasas finalmente no podrán mantener los niveles de saturación requeridos por las bacterias y como resultado, el crecimiento decaerá.

Las curvas que relacionan la tasa de crecimiento con la concentración de nutrientes son típicamente hiperbólicas y se comportan de acuerdo a la ecuación:

            µ = µmax   x       C/Ks  +  C

donde µ es la tasa específica de crecimiento dada para una concentración de nutrientes (C), µmax  es la tasa de crecimiento con la concentración saturada de nutrientes, Ks es una constante análoga a la de Michaelis-Menten de la cinética enzimática (por ejemplo para glucosa es de 1 x  10-6 M o 1.18 µg/ml. Estos valores son relativamente bajos y son atribuíbles a la actividad de las permeasas [1].


[1] Chapter 9. Microbial Growth. En: Stanier RY, Adelberg EA, Ingraham JL: General Microbiology. 4th Edition. Macmillan Publishers 1985. pp 286-287

Naturaleza y significado de los elementos de diferenciación en las células procarióticas.
Envolturas celulares
Todas las células procarióticas, con excepción de los micoplasmas, poseen una compleja envoltura que consta de una pared celular rígida que rodea a una membrana plasmática. La pared muestra variaciones de importancia en su configuración, por lo cual se hipotetiza que hayan surgido de adaptaciones evolutivas. Molecularmente la pared contiene un polímero denominado péptidoglicano o mureína, el cual está presente en todas las paredes celulares del reino Monera. El péptidoglicano está localizado cerca a la membrana plasmática y esta rodeado de lípidos, polisacáridos y proteínas, dispuestos en capas concéntricas. El péptidoglicano confiere rigidez a la estructura y forma a su vez el septo celular. 
Con el microscopio electrónico la capa de péptidoglicano se observa electrón-densa y curiosamente, se ha observado como la capa de péptidoglicano de células procarióticas marítimas es diferente a la de células procarióticas terrestres. Al estudiar la capa por fractura de congelamiento, se encuentra que por ejemplo, en E.coli hay dos estratos, mientras que en otros organismos como Acinetobacter puede haber cuatro estratos. La capa más externa es la capa que contiene los lipopolisacáridos a diferencia de la membrana plasmática no forma vesículas y su configuración tridimensional es como “hojas” (sheets) que se enrolla en capas concéntricas. Las bacterias gram-positivas poseen una pared que igualmente se dispone en forma concéntrica. 
Las envolturas celulares incluyen: 
Pared celular 
Gram-positivos                
  • Péptidoglicanos
  • Polisacáridos
  • Ácido teicoico
Gram-negativos
  • Lipolisacárido
  • Lipoproteínas
  • Péptidoglicanos
  • Membrana celular
        Membrana plasmática
  • Mesosomas
Reductores de sulfato
Quimioautotróficos
Fotosintéticos

Ribosomas

Ribosomas procarióticos

ARNr             23 S                 5 S       +          proteínas (L1,L2,L3)31 = subunidad 50S
                   2900 bases            120 bases
ARNr              16 S                            +          proteínas (L1,L2,L3) 21 = subunidad 30S
                   1540 bases

Ribosomas eucarióticos

ARNr              28 S + 5.8S                + 5 S    +          proteínas (L1,L2,L3) 50              =subunidad 60S
            4800 + 160 pares de bases;             120 bases
ARNr              18 S                                        +          proteínas (S1S2S3)33            =subunidad 40S
                   1900 bases

Las proteínas de la subunidad grande se denominan L1, L2, L3  (de large) y las pequeñas S1, S2, S3 (de small). El primer codón en la síntesis de proteínas es la incorporación del aminoácido  N-formilmetionina, pero no se inicia mediante el ARNtmet. sino mediante un ARNt iniciador, que contiene el anticodón normal para N-formilmetionina en lugar de metionina. El primer paso en la síntesis de proteínas es la unión del ARNm a la subunidad 30 S, proceso favorecido por el factor de iniciación IF3.

Ribotipificación

El análisis de RFLP usando genes de  ARN ribosomal, altamente conservados en la evolución, se denomina ribotipificación y ha sido ampliamente utilizado para la vigilancia epidemiológica de infecciones nosocomiales bacterianas. Kostman y colaboradores [1995], describen el uso de iniciadores de regiones conservadas a nivel de los genes 16S y 23S ribosomales de bacterias patógenas (Enterococcus, Staphylococcus, E. coli y Enterobacter) en estudios de  epidemiología molecular.

Definición de adherencia

Es el proceso por el cual los microbios se adhieren a superficies. En 1908 Guyot reconoció que que algunas bacterias se ligaban a eritrocitos, produciendo hemaglutinación. En 1935 Zo-Bell y Allen examinaron el proceso de adherencia bacteriana en ambientes marinos. El interés en la adherencia data de 1955 cuando Duguid y colaboradores comenzaron a publicar sobre las estructuras filamentosas bacterianas de microorganismos gram-negativos en relación a su adherencia a enterocitos. La adherencia no específica es importante por su capacidad para potenciar procesos específicos de adherencia.

La hidrofobicidad confiere una mayor tendencia a la adherencia a los tejidos animales. A nivel bacteriano, la expresión de la hidrofobicidad depende del estadío de crecimiento, de respuesta a a influencias ambientales o genéticas, o desencadanada por la presencia de otras estructuras de adhesión.  La hidrofobicidad promueve una adherencia más específica por permitir la aposición de dos superficies, de modo que la yuxtaposición queda asegurada para que tengan lugar las interacciones específicas entre moléculas complementarias. En los estafilococos coagulasa-negativos la hidrofobicidad permite la adherencia a superficies de catéteres, etc. La terminología de interés relacionada con el fenómeno de la adherencia microbiana comprende:·      

  • Adhesinas: son moléculas de  la superficie microbiana u organelas que funcionan para ligar el microorganismo a una superficie. Las adhesinas suelen reconocer configuraciones moleculares particulares (que definen un receptor) y la unión con tales receptores es específica. Las adhesinas en general son de tamaño pequeño, no suelen estar sujetas a las fuerzas de repulsión en la misma escala que la membrana de los microorganismos y permiten a este vencer el intervalo o distancia desde la membrana hasta el sustrato. Las adhesinas comprenden:
Orgánulos adhesivos
Moléculas adhesivas o ligandinas. 
Cuando las adhesinas del microorganismo se unen a una gran variedad de sustratos, suelen ser no específicas.
  • Adhesinas múltiples: existen microorganismos que no están limitados a un único sistema de adhesinas, el hecho de tener más de un sistema de adhesinas es biológicamente ventajoso para el microorganismo. Tal microorganismo aumenta la especificidad y el rango de su adherencia. Este es el caso de N. gonorrhoeae. El primer sistema de adhesinas comprende la adhesina organular conocida como pili gonocóccico; el segundo sistema comprende las denominadas proteínas externas de membrana (outer membrane proteins, OMP’s) tipo II. Los pili funcionan como adhesinas. Los pili tienen variación antigénica que surge espontáneamente por reestructuración del gen del pili. Tales cambios fenotípicos confieren variabilidad estructural y funcional a los pili, además de variación antigénica. A pesar de esta variabilidad la secuencia de aminoácidos son similares en los pili de N. meningitidis, Moraxella nonliquefaciens y P. aeruginosa.·      
  • Biofilm: consiste en microcolonias bacterianas embebidas en una matriz polisacárida y proteica producida por las bacterias. Este légamo/slime protege a la bacteria de injurias ambientales.La organización del biofilm es compleja, contiene las bacterias y permite que el complejo bacterias – película se adhiera a diferentes tipos de superficies, sean estas orgánicas o inorgánicas.
  • Slime(légamo): es una molécula perteneciente a la clase de las sustancias poliméricas extracelulares que también tiene una composición de tipo polisacárido. Se asocia débilmente con la superficie bacteriana y no tiene límites bien definidos como la cápsula. Generalmente el “slime” media la adherencia inespecífica de la bacteria a una superficie en un estrato legamoso/mucinoso/viscoso (slimy).
 Biofilm en sus diferentes estados.

En 1 se produce la primera incrustación a partir de bacterias planctónicas, es decir, individuales; en 2 hay mayor cantidad de bacterias incrustadas; en 3 los contactos entre las diferentes células se vuelven más fuertes; en 4 se empiezan a formar microcolonias; en 5, está unbiofilm maduro con gran contenido de agua en los intersticios, que está en condiciones de liberar bacterias planctónicas para empezar nuevamente el círculo de formación de biofilm.

Bacteria con fimbrias
Crédito de imagen:

    

La expresión fenotípica de las fimbrias de tipo I cambia a “encendido” – “apagado” entre generaciones alternas de bacterias, fenómeno conocido como variación de fase. En condiciones de cultivo, por tal variación de fase, coexisten poblaciones bacterianas con fimbrias y sin fimbrias. Las fimbrias permiten la adherencia en condiciones saprofíticas y de comensalismo.

  • Glicocálix: es una estructura de superficie que contiene polisacáridos, ubicada en la superficie externa de las células. Forma parte de la cutícula de los invertebrados, las paredes celulares de las plantas, la membrana basal de las células epiteliales, el cemento intercelular y las superficies ricas en carbohidratos de las células procarióticas y de los mamíferos. Se puede dividir en:
Glicocálix intrínseco: requerido para la viabilidad celular
Glicocálix extrínseco o “extraño”: no requerido para la viabilidad célular. Es equivalente al gel mucoso

  • Lecitinas: son proteínas ligadoras de carbohidratos, encargadas de aglutinar células o precipitar polisacáridos o glicoproteínas. La unión a las moléculas de carbohidratos son específicas, del mismo modo que la unión antígeno – anticuerpo. Las lectinas suelen mediar la unión de las bacterias a las células epiteliales del mismo modo que a los fagocitos.
  • Ligandina: es una molécula que exhibe un ligamiento específico para una molécula/sustrato complementario. Corresponde a las adhesinas de tipo molecular presentes en la membrana.
  • Gel mucoso: es una capa viscosa compuesta de mucinas, una clase de glicoproteínas producida por células especializadas que cubren las superficies mucosas en diferentes órganos de animales. Es quivalente al glicocálix extrínseco.
  • Pili sexual: es una subclase de fimbria que une a células procarióticas entre sí para la transferencia de ADN por conjugación.
  • Receptores: son las moléculas/sustratos complementarios a los que se unen las ligandinas específicas o adhesinas. La presencia de receptores en las células del huésped explica los fenómenos de colonización o infectividad. Los receptores del huésped comprenden dos clases principales:
Residuos de monosacáridos del glicocálix: son los componentes submoleculares de estructuras más grandes que funcionan como receptores. El residuo sacárido funciona como un sitio activo, en el cual la orientación del sacárido y la presencia concomitante de otra estructuras submoleculares es importante para la especificidad de la interacción entre la adhesina molecular y el receptor. Las moléculas portadoras de los residuos de sacáridos suelen ser glicoproteínas o glicolípidos.
Proteínas de superficie celular: incluye la fibronectina, la cual característicamente liga cocos gram – positivos.
  • Sustrato: es la superficie a la cual la bacteria se liga.
  • Cápsulas: son una subclase de sustancias poliméricas extracelulares de naturaleza polisacárida. Generalmente se unen estrechamente a la superficie  y poseen un borde externo distintivo. En general inhiben la fagocitosis. 
  • Coagregación: es un estadío de la colonización bacteriana en el cual el microorganismo usa los mismos procesos de adherencia, pero el sustrato no son otras superficies, sino otros microorganismos. La coagregación permite la acumulación de colonias relativamente de microorganismos sobre una superficie.
  • Sustancias poliméricas extracelulares: usualmente son sustancias poliméricas de tipo polisacárido que incluyen los “slime”; son sinónimos de glicocálix extracelular. 
  • Fibrillas (fibrillae): son las finas estructuras de las células “peludas”. Son irregulares en tamaño y forma.
  • Fimbrias: también denominados pili, son estructuras filamentosas no flagelares en las células bacterianas. Tienen una estructura y un diámetro regular. Generalmente aunque no exclusivamente, funcionan como adhesinas. Las fimbrias son adhesinas de tipo organular que muchos microorganismos usan como adhesina específica.El prototipo de la fimbria por excelencia es la tipo I. Es expresada por la mayoría de las enterobacterias, les permite la adherencia a células animales, de protozoos y hongos. Se une a un receptor de tipo oligosacárido que varía de acuerdo a los géneros. Las bacterias suelen contener aprox. 50 – 400 de estos filamentos proyectándose desde la superficie. Las fimbrias se irradian hacia afuera, donde sus extremos hidrofóbicos entran en contacto con otras células y sustratos.

El proceso de adherencia

De acuerdo a la teoría coloidal de Derjaguin-Landau y de Verwy y Overbeek (teoría DLVO), todos los objetos en inmersión atraen microorganismos a sus superficies. La teoría coloidal describe la atracción explicada por una serie de interacciones débiles que incluyen gravitación, quimiotaxis, fuerzas electrostáticas, fuerzas de Van der Waals y tensión de superficie. Es necesario tomar en consideración que si las partículas poseen la misma carga en la superficie, lo cual ocurre en células procarióticas que se adhieren a células eucarióticas, ambas cargadas negativamente, hay una repulsión de cargas, lo cual tiende a repeler las células entre sí. El resultado de esta interacción electrostática es que las partículas quedan débilmente adheridas. Esta posición de adherencia débil es llamada el “mínimo secundario” o adsorción (con d). 
 La adsorción es el fenómeno por el cual una sustancia primitivamente disuelta en un líquido se fija sobre un sólido o sobre partículas de un coloide en suspensión. La adsorción es un proceso reversible, las partículas pueden tanto adsorberse como desorberse. Si la partícula vence las fuerzas de repulsión unas fuerzas de atracción, de rango de acción a más corta distancia entran en juego. Estas fuerzas de atracción de mayor intensidad vienen dadas por puentes hidrofóbicos, por enlaces de tipo covalente, por enlaces de puentes de hidrógeno y por enlaces iónicos. 
  La teoría DLVO describe este tipo de unión con enlaces de  mayor fuerza como el “mínimo primario”. Las partículas que se adhieren con el enlace de tipo “mínimo secundario” se ligan irreversiblemente a la superficie.La adherencia es el proceso por el cual las bacterias pasan del estado de “mínimo primario” al estado de “mínimo secundario”. Hay un gradiente o barrera energética que separa los estados de mínimo primario” del “mínimo secundario”. Este gradiente de energía puede ser vencido de varias formas, las bacterias generalmente lo logran: en los ambientes acuosos, como en las mucosas, la hidrofobicidad de la superficie microbiana promueve la cercana asociación de los microorganismos con las regiones lipofílicas de las membranas de las células eucarióticas, de modo que muchos microorganismos logran la adherencia. Otros compuestos como el slime o légamo bacteriano se logran unir a sustratos o superficies de adherencia, a manera de una “goma”.Algunos ejemplos de mecanismos de adherencia microbianos incluyen:
  • Ácido lipoteicoico (adhesina estreptocóccica): hay una capa de fibrilas irregular cubriendo la superficie del estreptococo. Estas fibrilas se unen a las células epiteliales humanas, están compuestas de proteína M, ácido lipoteicoico y otras moléculas aún no identificadas. El acido lipoteicoico es una molécula anfipática que se puede unir virtualmente a cualquier célula eucariótica. El estreptococo vierte constantemente acido lipoteicoico al exterior y el acido lipoteicoico puede formar complejos con la proteína M.Las superficies hidrofóbicas promueven el contacto celular entre células procarióticas y eucarióticas. El acido lipoteicoico contribuye a la hidrofobicidad en la superficie, favoreciendo por tanto dicha adherencia (coagregación).
  • Fimbrias: la adherencia mediada por tales adhesinas organulares es mejor ejemplificada porEscherichia coli. Su dotación de fimbrias incluye:
    • fimbrias comunes
    • fimbrias de coloniación entérica (presentes en la ETEC)
En estas fimbrias, la hemaglutinación no es inhibida por manosa, de aquí el nombre de fimbrias resistentes a la manosa. El gen de esta fimbria está en ADN plasmídico y su expresión fenotípica suele ocurrir a temperaturas de 37ºC, pero no a temperatura ambiente. El calostro suele contener anticuerpos que inmunizan pasivamente contra la colonización entérica mediada por esta fimbria.
  • fimbrias P de Escherichia coli uropatógena
Igual que la anterior es resistente a manosa
Las fimbrias de tipo I permiten que Escherichia coli se adhiera a cualquier tejido humano.

Definición de quimera

Los plásmidos poseen un rasgo que hace posible la creación de quimeras genéticas moleculares de genomas autorreproductores cuya secuencia de nucleótidos representa una mezcla de información genética incluso más grotesca que la mezcla de genes de leon, de cabra y de serpiente con los cuales estaba dotado el monstruo mitológico ultimado por el héroe Belerofonte,  la quimera. Este rasgo genético del ADN plasmídico es que puede replicar todas las secuencias adicionales -entiéndase por adicionales: de otra especie- de nucleótidos independientemente de su procedencia junto con todos aquellos loci genéticos que son necesarios para su propia replicación en la célula huésped.
 Los procedimientos para la construcción de un plásmido quimera empiezan con la ruptura del ADN plasmídico así como del ADN que se quiere insertar, con una nucleasa de restricción, tal como como la EcoRI que produce extremos cohesivos en el lugar de la ruptura. Las enzimas de restricción producen cortes en secuencias específicas, produciendo una población heterogénea de fragmentos de ADN con extremos idénticos. La mezcla de los fragmentos generados así se calienta y luego se enfría bajo condiciones que favorezcan la asociación de los fragmentos a través de sus extremos cohesivos. De este modo se producen in vitro moléculas mixtas de ADN híbrido. A continuación las moléculas mixtas aún lineales se transforman en ADN circular por la adición de una ligasa de ADN junto con sus cofactores a la mezcla de la reacción. Esta molécula de ADN recombinante constituye un plásmido quimérico que luego al ser incorporado a una cepa de Escherichia coli competente para incorporarlo a su genoma expresa los genes exóticos que le han sido incorporados [1].

[1] Stent GS, Calendar R: Capítulo 19. Operaciones del ADN. En: Genética Molecular. Ediciones Omega. Barcelona, 1981. pp 604; Griffith A, Miller J, Suzuki D, Lewontin R, Gelbard W et al: Una introducción al análisis genético.Edit. Interamericana – McGrawHill Madrid, 1993. pp 432

¿Qué es un plásmido ?

Es una molécula de ADN circular presente en las células procarióticas, de localizacion extracromosómica y de replicación independiente. Al igual que el cromosoma bacteriano, su estructura es circular. Algunos plásmidos se replican en sincronía con el cromosoma bacteriano y cada célula hija tiene una copia del plásmido. Otros plásmidos en cambio, se replican asincrónicamente, caso en el cual una sola célula hija tendrá múltiples copias.

¿Qué es un transposón ?

Se define como la secuencia de ADN que lleva desde uno a más genes a una posición diferente en el cromosoma. Los transposones simples se conocen como secuencia de inserción llevan solamente los genes necesarios para la transposición, mientras que los transposones complejos portan genes implicados en la síntesis de proteínas adicionales.
La transposición genética define la transferencia de segmentos cromosómicos de una posición a otra durante las reorganizaciones estructurales más importantes. Son susceptibles de transposición uno o varios genes ligados, o bien un segmento de ADN del tamaño de un gen. Los elementos genéticos transponibles parecen ser capaces de moverse a nuevas posiciones en el mismo o en diferentes cromosomas.
Los transposones bacterianos son semejantes a los existentes en otros organismos.

Episomas

El episoma designa las partículas genéticas que presentan los estados característicos de ser tanto elementos citoplasmáticos libres que se transfieren con facilidad a las células recipientes F, así como parte integrante de un cromosoma circular que únicamente se transfiere en los momentos tardíos de la conjugación. El episoma es un factor genético bacteriano que puede encontrarse como elemento aislado en el citoplasma o como parte integrante de un cromosoma. El factor F es un episoma. Aunque las opiniones de diferentes autores puedan definir al episoma del mismo modo que un plásmido, para efectos prácticos se considerará que el ADN libre en el citoplasma bacteriano es unplásmido, y que tales plásmidos incorporados al cromosoma, son los episomas.
Las células portadoras del plásmido del factor de fertilidad (F de fertility) en estado libre se denominan F+, las células con F en estado libre en el citoplasma se denominan Hfr (de High Frequency Recombination) y las células sin F son las F . Existe adicionalmente el factor F’ (F prima), que en estirpes F+ origina la conversión a estirpes Hfr. Característicamente F’ se integra siempre en la misma posición, originando nuevamente el cromosoma Hfr original. Estas propiedades vienen explicadas porque F’ es un ADN citoplasmático (por lo tanto, por la localización extracromosómica, un plásmido), pero con integración de parte del cromosoma del huésped. Este factor F’ más exactamente se conoce como F’-lac porque el fragmento cromosómico incorporado contiene el gen lac. El factor F’ tiene características de plásmido, por estar en el citoplasma, y de episoma, por contener material genético del cromosoma bacteriano. Tiene características de diploídia parcial o meroploídia por la razón de contener segmentos específicos de cromosoma del genomio bacteriano. La utilización de tales plásmidos F’ para crear diploides parciales se conoce como sexducción o F’ducción.
En E. coli y otras bacterias se han encontrado elementos infecciosos diferentes a F. Cuando F o cualquier otro factor se encuentra en el citoplasma, se denomina plásmido. Los fagos temperados son episomas que puede integrarse en el cromosoma del mismo modo que el factor F.
Los plásmidos son moléculas adicionales de ADN presentes en casi todas las bacterias. Suelen ser más pequeños que el cromosoma bacteriano, pueden contener desde 2 hasta 30 genes. Pueden entrar y salir del cromosoma bacteriano. Los plásmidos incorporados al cromosoma bacteriano son conocidos como episomas [1].
Las células Hfr no mueren después de donar su cromosoma a células F. El cromosoma Hfr se replica mientras se va transfiriendo una cadena sencilla a la célula F– . De esta manera queda un cromosoma completo en la célula donante después de la conjugación. La cadena transferida se replica en la célula recipiente y los genes de la célula donante se pueden incorporar al cromosoma de la célula recipiente por recombinación, generándose así una célula recombinante.
Las células Hfr y las F+ tienen unas estructuras fibrosas denominadas los pili F, que sobresalen de la pared celular. Los pili F facilitan el contacto de las células, contacto durante el cual ocurre la transferencia de ADN, aparentemente a través de poros presentes en la célula F , aunque el mecanismo de transferencia no está claro del todo.
Durante la conjugación entre un donante Hfr y una célula bacteriana F , los genes de la célula bacteriana donante se transmiten linealmente (mecanismo del círculo rodante) mediante el cromosoma bacteriano, siendo el factor de fertilidad F el último que se transfiere.

Intercambio genético en procariotas

El intercambio genético entre células procarióticas no tiene lugar entre dos genomios completos, sino entre un genomio completo el de la célula F , y un genomio incompleto que es el de la célula donante. El genomio completo se denomina endogenote, el genomio incompleto se denomina exogenote. El producto celular de la combinación de un endogenote con un exogenote es un merocigoto, o diploide parcial. La genética bacteriana es una ciencia que trata sobre la merocigosis.
Las recombinaciones aisladas no son útiles en la generación de cromosomas viables, porque se rompería la circularidad del cromosoma y se formaría tan solo un cromosoma lineal extraño parcialmente diploide. De modo que para conservar la circularidad del cromosoma se requieran un par de entrecruzamientos, de modo que parte del ADN del exogenote se incorpore al ADN circular del endogenote, produciendo un merocigoto diploide (con dos dotaciones genéticas diferentes) viable y un fragmento de ADN lineal no viable, con una menor longitud en bases después de producidos los entrecruzamientos. Dicho de otra forma, la recombinación de moléculas de ADN de bacterias diferentes produce un genomio viable y uno no viable. En la genética de los merocigotos lo relevante es el estudio de los entrecruzamientos de las moléculas de ADN y no los llamados “recombinantes recíprocos” [2].

El gradiente de transferencia

En la célula bacteriana recipiente de las dotaciones genéticas ya realizados los entrecruzamientos del endogenote y el exogenote (exogenote ADN lineal, endogenote ADN circular) ocurren en forma parcial, lo cual significa que rara vez se transfiere el cromosoma en su totalidad, porque una vez se inicia la transferencia, puede ocurrir la rotura espontánea en cualquier momento. Esta situación de la origen al gradiente de transferencia, que significa que es menos probable que una célula recipiente reciba genes en la medida que más “tardíos” sean estos.            

leu+                 arg+                 met+            —————————————>                                       arg+                 met+                                   ———————->
met+
                                                           —->

En la medida que existen más locus met que locus arg , si el sentido de la flecha indica proximidad, es más probable que se transfiera un locus cercano (met), que un locus más tardío (leu). La proximidad equivale al gradiente de transferencia. Los locus arg y leu son sucesivamente más tardíos.El gradiente natural de transferencia permite establecer un orden en los marcadores genéticos: esto es posible en la medida en que se seleccione (artificialmente por un ingeniero genético, por ejemplo), un marcador temprano (más próximo). Los gradientes para cada locus podrían hipotéticamente ser, de acuerdo a resultados típicos:                                                           met+      100 %                     arg+      60 %                      leu+       20 %

Explicando en forma redundante esta discriminación porcentual sobre el gradiente de los locus que se transfieren al merocigoto, la frecuencia porcentual se corresponde con el orden de transferencia. Hay mayor gradiente de transferencia para met comparado con arg y mayor para arg comparado con leu [3].La elaboración de mapas genéticos por experimentos de conjugación ofrece la dificultad de que solamente se transfieren frgamentos del cromosoma y en virtud del gradiente de transferencia se produce una tendencia a transferir aquellos locus más cercanos al origen. Si, volviendo a la secuencia met-arg-leu, met es el primero que se transfiere y leu el último, el marcador que se debe seleccionar para que aparezca en la secuencia que se transfiere es leu, porque dará la seguridad que los merocigotos recibieron los locus previos met y arg.

El proceso de conjugación en Escherichia coli.

El proceso de conjugación de Escherichia coli es diferente para cada una de las células F , F+ o Hfr.
En las células F , la carencia del factor de fertilidad no permite que se pueda trasferir ADN por conjugación, pero sí pueden actuar como recipientes del ADN transferido desde células Hfr o F . Las células F+ contienen el factor de fertilidad en el citoplasma, por lo cual lo pueden transferir a células F  durante la conjugación.  Las células Hfr tienen el factor de fertilidad F integrado en el cromosoma bacteriano, no así en el citoplasma. Las estirpes de células F+ transfieren marcadores cromosómicos porque en cualquier población de estas, una proporción de aproximadamente 1 cada 1000 células se ha convertido en Hfr por la integración del episoma F en el cromosoma bacteriano.
Las estirpes Hfr se originan a partir de un clon de células Hfr en las que ha ocurrido una integración específica del factor F en el cromosoma bacteriano. A diferencia de las células F+, las Hfr transmiten marcadores cromosómicos con una mayor frecuencia que las células F+ , con un orden determinado y desde un punto fijo, también a diferencia de las células F+.
En los cruzamientos Hfr x F las células F  a diferencia de lo que se podría esperar, raras veces se convierten en Hfr o F+, porque el cromosoma Hfr se suele romper antes de que F se transfiera completamente a la célula F  [4].
La transferencia del plásmido F desde las células F+ hasta las F se hace por un mecanismo de replicación conocido como “rueda rodante” en la cual  la molécula de ADN en replicación líneal en sentido 3′ a 5′ se dirige a la célula F donde dicho ADN se enrollará en sentido 5′ a 3′ [5].

[1] Curtis H, Barnes NS: Biología. 5ª Edición. Editorial Panamericana, Madrid España, 1993. pp 349.

[2] Griffith A, Miller J, Suzuki D, Lewontin R, Gelbard W et al: Una introducción al análisis genético. Edit. Interamericana – McGrawHill Madrid, 1993. pp 284

[3] Griffith A, Miller J, Suzuki D, Lewontin R, Gelbard W et al: Una introducción al análisis genético. Edit. Interamericana – McGrawHill Madrid, 1993. pp 285

[4] Griffith A, Miller J, Suzuki D, Lewontin R, Gelbard W et al: Una introducción al análisis genético. Edit. Interamericana – McGrawHill Madrid, 1993. pp 284

[5] Curtis H, Barnes NS: Biología. 5ª Edición. Editorial Panamericana, Madrid España, 1993. pp 350

Fagos temperados (temperate phagues; fagos atenuados)

Los fagos se clasifican en dos grupos:
  • Fagos virulentos: se caracterizan por un ciclo infeccioso que siempre lleva a lisis celular. No hay bacterias lisogénicas para estos fagos. Aunque podrían existir mutantes bacterianos resistentes a los fagos virulentos, pero la resistencia no se debe a la lisogenia. Los fagos virulentos no pueden convertirse en profagos, son siempre de tipo lítico.
  • Fagos temperados: se caracterizan por dar origen ocasionalmente a ciclos líticos. En el inicio de los ciclos lisogénicos el fago temperado se conserva en el genoma bacteriano como un profago. En este caso, la bacteria desarrolla resistencia a una nueva infección y dicha inmunidad es conferida por la presencia del profago, es transmisible durante varias generaciones. Pero si el profago es inducido o activado, llega a producir lisis bacteriana. Los fagos temperados se pueden mantener en la célula bacteriana como profagos [1].
La TRANSDUCCIÓN consiste en la transferencia del ADN celular de una bacteria a otra por intermedio de un virus. Durante el ciclo lítico de muchos virus la fragmentación del ADN de la célula hospedadora es causa de asociación del ADN viral con partes del ADN de dicha célula hospedadora. el ADN viral una vez realizado el ciclo lítico tiene capacidad infectante, pero no es capaz de completar un nuevo ciclo lítico.  Pero los genes o los fragmentos de estos que vienen desde el hospedador previo están en capacidad de incorporarse al ADN de la nueva bacteria hospedadora. En este proceso de transducción general, prácticamente cualquier gene puede ser transferido.
La transducción se produce cuando fagos que están formándose de novo incorporan genes del hospedador y los transfieren a otras células bacterianas.En la transducción generalizada el fago puede transmitir cualquier gen del huésped. Este fenómeno ocurre cuando los fagos que están empaquetándose accidentalmente incorporan ADN bacteriano en lugar de su propio ADN viral. Este fenómeno se produce durante el ciclo lítico de algunos fagos virulentos y atemperados, o cuando se induce la lisis de un profago temperado. La transducción especializada solo ocurre durante la inducción de profagos. Se debe a una excisión defectuosa del profago bacteriano, de modo que el nuevo fago incluye genes tanto del porio fago como del cromosoma bacteriano. Los fagos transductores especializados solamente pueden transferir genes específicos del huésped, por la razón que el fago temperado está insertado en un locus bacteriano específico.
Hay dos clases de transducción: generalizada y especializada. Los fagos transductores generalizados pueden transportar cualquier parte del cromosoma, mientras los fagos transductores especializados solo pueden transportar regiones específicas del cromosoma bacteriano. Los fagos transductores generalizados incluyen el P1 y el P22, el cual rompe el cromosoma bacteriano de células bacterianas no lisogénicas en porciones pequeñas. Los genes transducidos pueden incorporarse en una célula recipiente por recombinación, originando una célula meroploide con cualquier marcador de ADN de la célula donante. Ambos fagos P1 y P22 son capaces de transducción de ADN por empaquetamiento erróneo de la cápside durante la lisis.
Por el contrario, el fago lambda es un transductor especializado. Dada su proximidad con los locusgal y bio, solamente va a ser capaz de transducir estos genes. Al realizar inducción, el profago sufre escisión anormal, originando partículas que solamente contienen el gen gal, en consecuencia se denominan lambda-defectuoso gal. Esta partícula defectuosa no se integra eficazmente porque no es substrato adecuado para la enzima específica que induce la recombinación. La transducción especializada solo puede movilizar pequeñas regiones del cromosoma bacteriano adyacentes al profago.
En algunas cepas de E. coli (la denominada K12) al ser irradiadas con UV, se observa al cabo de varias generaciones que la lisis de todas las células, lisis debida a los fagos lambda, que están latentes y no producen lisis celular, ya que no entran en fase vegetativa y se mantiene a lo largo de las generaciones. Las bacterias que transportan estos fagos se denominan lisógenas, ya que el fago ante un estímulo adecuado (inducción) puede pasar de una fase latente a una fase vegetativa, de un modo semejante a los fagos T [2]. Algunas bacterias de E. coli de la cepa K12 sufren lisis espontánea liberando partículas del fago lambda, mientras que otras bacterias permanecen normales, por lo cual se habla de “inmunidad al fago lambda”. La inmunidad es específica para este fago lambda, no se observa con los fagos T.
En el medio intracelular el fago se ha denominado “profago” (Lwoff), el cual equivale al “determinante lisógeno”. La replicación del profago y la división celular son fenómenos sincrónicos y el carácter de “lisogenicidad” permanece estable a lo largo de las generaciones bacterianas. El profago está insertado en el cromosoma bacteriano, en un sitio específico en cercanía del logus gal.La inducción ocasiona la liberación del material genético que se hace autónomo con respecto al cromosoma bacteriano [3]. Los profagos se separan espontáneamente del cromosoma del cromosoma hospedador con una frecuencia de 1:10.000 divisiones celulares, desencadenando entonces un ciclo lítico. Los fagos atenuados se asemejan a los plásmidos en que son moléculas de ADN que se replican en forma autónoma y en que pueden integrarse al cromosoma bacteriano. Difieren de los plásmidos en su capacidad para elaborar cubiertas proteicas y de existir por fuera de la célula, aunque sin perder la capacidad de replicación en el medio extracelular [4].
¿ Por qué el profago permanece como tal, entrando en estado latente y no produciendo un estado vegetativo lítico ?
Este fenómeno se explica por  la presencia de un “represor citoplasmático” que actúa impidiendo la síntesis de las proteínas precoces. La entrada del profago en un ambiente no lisogénico diluye inmeditamente el factor represor citoplasmático, produciéndose la reproducción del virus, produciendo ciclo, lítico en unas células y simultáneamente reprimiéndose a si mismo en otras, originando células inmunes lisogénicas. Hay una competencia entre las señales genéticas del fago de tipo lisogénico y de tipo lítico.
El profago en la bacteria lisogénica de algún modo protege a la célula evitando que ocurran nuevas infecciones o sobreinfecciones por otros fagos libres; mientras tanto el profago se duplica y se transmite a las células hijas durante la división. El ciclo posterior del profago es que en una pequeña proporción de las células hijas el porfago se induce para producir fagos infectivos, proceso que elimina la protección de la célula contra el fago, por lo cual ocurre lisis y la liberación de fagos infecciosos al medio, infectando a células bacterianas no lisogénicas. De acuerdo a esto, los fagos temperados o atenuados pueden seguir un ciclo lítico en determinadas circunstancias, pero lo normal es el inicio de un ciclo lisogénico, en el que el fago se mantiene en la célula bacteriana como un profago. Los fagos temperados pueden inducir lisis cuando son inducidos o activados. El profago lambda se encuentra generalmente en la célula F, estrechamente ligado al locus gal.
La lisogenia implica la existencia de bacterias resistentes a la lisis que pueden inducir la lisis de otras células bacterianas:
·      Posibilidad que la bacteria pueda liberar un determinado fago
·      Inmunidad con respecto a este fago
La producción del fago lambda por la cepa K12 de E. coli es de carácter simultáneamente potencial y letal, y la expresión activa de este carácter produce la muerte de  la célula.
El profago se entrecruza con el cromosoma de Escherichia coli, en un sitio específico denominado elsitio de integración de lambda, que esta situada entre los genes gal bio. La integración del profago produce un aumento de la distancia genética entre los marcadores bacterianos adyacentes mencionados.

Amplificación mediante la replicasa Qb

Este método se denomina así porque utiliza la enzima responsable de la amplificación es la replicasa del bacteriófago Qb. Es una ARN polimerasa que permite hacer múltiples copias de ARN utilizando una cadena de ARN como molde. Molecularmente esta enzima se compone de cuatro subunidades, una es del bacteriófago Qb, y las otras tres son del huésped, la E. coli.
Este sistema fue reportado por Haruna y colaboradores en 1965. El posterior descubrimiento de la molécula de ARN llamada midivariante 1 (MDV-1), permitió su uso para la amplificación de ácidos nucleicos, ya que esta molécula actúa como un blanco para la replicasa Qb. Si una sonda de captura con moléculas de MDV-1 se une a la secuencia complementaria, al adicionar la replicasa Qb se producirán miles de copias de la MDV-1. Aunque la PCR y la replicasa Qb amplifican ácidos nucleicos, la amplificación de ARN con este método sirve como un sistema que reporta muchas más señales y se incrementa la cantidad de ARN a detectar. El producto amplificado puede ser identificado utilizando un colorante intercalante fluorescente, como el bromuro de etidio. En un período menor a 15 minutos, la replicasa Qb puede producir de un millón a un billón de copias de ARN MDV-1. Unas cien copias de moléculas de ARN pueden ser amplificadas hasta 125-200 ng, una amplificación de un billón de veces. Además estas reacciones de amplificación de ARN pueden ser cuantificadas por sencillas técnicas colorimétricas que permiten hacer curvas que determinen la cantidad de ARN detectado o amplificado. Recientemente, Shah y colaboradores describen la aplicación de esta técnica para la detección de Chlamydia trachomatis en orina, detectando  bajos niveles de ácidos nucleicos en menos de 4 horas, con un excelente rendimiento.
Una variante en la amplificación con replicasa Qb, descrita por Cahill y colaboradores [1991], es el desarrollo de sondas de captura reversibles. En esta técnica una cola de poli(dA) está unida a la sonda de captura y se usan micropartículas magnéticas las cuales tienen unidas sondas con poli(dT) las cuales se unen a las complementarias de poli(dA), y de esta manera se eliminan de la reacción muchas moléculas contaminantes reduciendo la interferencia. El uso de sales caotrópicas ayuda también en la reacción de amplificación con replicasa Qb, ya que estas sales lisan las células, denaturan las proteínas (incluyendo las endonucleasas), liberan y linearizan el ADN sin interferir con la hibridización de la sonda de MDV-1.
Algunas modificaciones de las sondas de MDV-1 incluyen la adición de un “interruptor molecular” a una región de la sonda, y el uso de sondas que no son replicativas pero que pueden sintetizarse usando  reporteros de ARN. El interruptor molecular ayuda a limpiar la reacción, eliminando sondas no hibridizadas que pueden causar reacciones falsas positivas; por ejemplo, la secuencia de la sonda pueden incorporar sitios de unión a ARNasa III sobre la molécula de MDV-1. Si la molécula de MDV-1 no hibridiza, el sitio de unión a la ARNasa permanece intacto y está disponible para la destrucción por la ARNasa; si la molécula de MDV-1 hibridiza, la secuencia de la sonda une las cadenas complementarias formando una asa, que oculta o destruye el sitio de unión a la ARNasa III. El ARN MDV-1 puede también ser sintetizado a través de la acción de dos sondas separadas, las cuales contienen por aparte una secuencia promotora de la polimerización y una secuencia que puede servir como un iniciador en sus dos extensiones. En dos pasos separados de hibridización y extensión, una región promotora de ADN de doble cadena puede transcribir un ARN replicable con la ayuda de la polimerasa, y luego este ARN puede luego ser amplificado usando la replicasa Qb.
Aunque estas pruebas aún no se encuentran comercializadas, Lawrence y colaboradores [1990], describen la aplicación de esta técnica para la detección de ácidos nucleicos en citomegalovirus y VIH.

[1] Griffith A, Miller J, Suzuki D, Lewontin R, Gelbard W et al: Una introducción al análisis genético. Edit. Interamericana – McGrawHill Madrid, 1993. pp 295 [2] “T” de type. [3] BerkaloffA, Bourguet J, Favard P, Guinnebault M: Biología y Fisiología Celular. 6ª Edición, Edit. Omega Barcelona, 1977. pp 257-281 [4] Curtis H, Barnes NS: Biología. 5ª Edición. Editorial Panamericana, Madrid España, 1993. pp 354

Metabolismo bacteriano como un determinante ecológico

Modos de conversión de energía

Crecimiento anaeróbico
La capacidad de crecer indefinidamente bajo condiciones anaeróbicas es casi exclusiva de las células procarióticas. La energía para el crecimiento anaeróbico a nivel bacteriano proviene de cualquiera de estas vías: 
  • fotosíntesis anoxigénica
  • generación de energía por respiración anaeróbica
  • generación fermentativa de energía  
En la fotosíntesis anoxigénica las bacterias anaerobicas fototróficas producen energía a partir de la luz; el agua no es la última molécula reductora, de forma que requieren la presencia de otros compuestos como alcoholes, carbohidratos, sulfuro de hidrógeno, sulfuro o hidrógeno. Existen dos grupos principales, a saber: las bacterias púrpuras y las verdes. De acuerdo al tipo de metabolito que emplean para como reductor, se pueden subdividir en bacterias sulfurosas y no sulfurosas. Bacterias como las pertenecientes a la familia Chromatiaceae  y Chlorobiaceae pueden usar compuestos reducidos de azufre  y oxidarlos de sulfuro elemental a sulfato. Chromatiaceae no puede oxidar el azufre elemental. La conversión de energía por respiración anaeróbica es bastante similar a la respiración aeróbica con respecto a los donantes de electrones que pueden ser moléculas bien orgánicas o bien inorgánicas. Los aceptores externos de electrones son moléculas como nitrato, sulfato, sulfuro, carbonato y fumarato. Las bacterias denitrificadoras utilizan NO3 para producir nitrógeno, óxido nitroso y nitrito. Las bacterias sulfato-reductoras producen Sa partir de sulfato. Las bacterias que reducen el sulfuro producen sulfuro  S2-. Las bacterias metanogénicas merced a la respiración tipo carbonato,  producen amoníaco. Por su parte, las bacterias acetogénicas producen ácido acético y las bacterias succininogénicas, por la “respiración de fumarato”, utilizando el fumarato como aceptor de la cadena de electrones originan succinato como producto final.  La fermentación implican la producción de compuestos reducidos tales como alcoholes, ácidos orgánicos, amoníaco, hidrógeno y dióxido de carbono como metabolito de oxidación. Las bacterias fermentativas se disponen en grupos de acuerdo a los productos de fermentación producidos que reflejen sus vías metabólicas. La producción de energía por la vía fermentativa depende de compuestos orgánicos que se usan como donantes de electrones y como aceptores de electrones. Estos compuestos son metabolitos derivados de azúcares  u otros compuestos.

Donantes de electrones inorgánicos 

La capacidad de usar compuestos inorgánicos como donantes de electrones se conoce como litotrofismo o también como quimiolitotrofismo. Es una capacidad exclusiva de las células procarióticas. El transporte de electrones se realiza durante la fosforilación aeróbica con oxígeno o anaeróbica para la reducción de moléculas inorgánicas como nitrato, sulfato, carbonato y la oxidación de dióxido de carbono, molécula que es la fuente de carbono en las bacterias quimiolitotróficas  

·       Fermentación de etanol ·       Fermentación de lactato ·       Fermentación de butirato ·      Fermentación de homoacetato ·       Fermentación de propionato y succinato ·       Fermentación de butanediol y ácidos mixtos ·      Fermentación de compuestos nitrogenados

Fijación del nitrógeno molecular

Aunque el hombre y los demás seres están inmersos en el gigantesco oceáno de nitrógeno del contenido atmosférico, cuya proporción en la composición llega al 79 %, su disponibilidad en los alimentos es limitada por la presencia de nitrógeno fijado. Este nitrógeno fijado se define como aquel presente en un compuesto químico que pueda ser utilizado por las plantas y animales. Solo una pequeña proporción del nitrógeno atmosférico puede ser empleado directamente por algunos microorganismos que tienen la capacidad de convertir el nitrógeno molecular a una forma combinada. Una pequeña proporción del nitrógeno atmosférico es fijado por fenómenos tales como radiación cósmica, relámpagos, entre otros, por la razón que proveen los altos requerimientos energéticos para que el nitrógeno reacciones con el oxígeno o con el hidrógeno del agua. Aunque el nitrógeno es fijado por las células del medio marino, la fuente natural de mayor tamaño la constituyen los microorganismos terrestres y las asociaciones entre organismos y plantas. 
La nitrificación indica grosso modo la adición de nitrógeno a algún otro compuesto, aunque consiste en una serie especializada de reacciones por las cuales unas pocas especies de microorganismos producen oxidación del ión amonio NH4+ hasta el ión nitrito NO2-, o nitrato NO3-. Cuando los nitritos o los nitratos son reducidos a la molécula volátil de nitrógeno (N2) u óxido nitroso (NO2), este proceso inverso se conoce como desnitrificación. La amonificación describe el proceso por el cual el nitrógeno de los compuestos orgánicos se convierte en amonio. El proceso inicia una vez que el animal o la planta mueren.
La importancia del nitrógeno en el proceso de la vida radica en que es una molécula con un gran número de niveles de oxidación o valencias. El nivel de oxidación indica que número de electrones en un átomo en particular se han donado o aceptado. En las plantas y animales la mayoría del nitrógeno existe en la forma de iones amonio o compuestos amino (-NH2). En cualquier de ambos casos la molécula está altamente reducida, porque ha adquirido tres hidrogeniones por sus asociación con otros átomos y su valencia es de -3. En el extremo opuesto, cuando el nitrógeno está en la forma altamente oxidada en el ión nitrato, su valencia es de +5, empleadas en la neutralización del oxígeno. La conversión de nitrógeno desde amonio hasta nitrato implica un cambio de 8 valencias o una remoción de 8 electrones. Las reacciones del suelo producen nitrato por reducción, y la agregación de electrones libera mayor cantidad de energía comparativamente con las reacciones de oxidación. Como una regla general, se puede decir que aquellos procesos en la naturaleza en los cuales la producción de energía por la conversión de una molécula a otra sea al menos de 15 kcal por mol, existirá un grupo de microorganismos que explotará esta energía para sobrevivir. La fijación del nitrógeno requiere una inversión en términos energéticos. La activación del nitrógeno consume aproximadamente 160 kcal por cada mol de nitrógeno fijado (que equivale a 28 gramos). Por ejemplo, la unión de nitrógeno a 3 moléculas de hidrógeno libera cerca de 13 kcal, de modo que los pasos adicionales implican una inversión energética de 147 kcal. 
Una vez el amonio ha aparecido en el suelo, puede ser absorbido por las raíces de las plantas y el nitrógeno puede ser incorporado en forma de aminoácidos o proteínas. Desde el punto de vista bacteriano algunos microorganismos como Nitrosomonas realiza la nitrificación del amonio como su única fuente de energía. En presencia de oxígeno el amonio es convertido a nitrito (NO2) más agua, liberándose a partir de esta reacción alrededor de 65 kcal por mol de N2. Este microorganismo es por tanto, un quimiolitotrófico por la obtención de energía a partir de compuestos inorgánicos. En el suelo existe una gran cantidad de bacterias desnitrificantes (por ejemplo Pseudomonas denitrificans) que son obligadas a sobrevivir en ausencia de oxígeno. Esta característica permite que use el nitrito o el nitrato como los aceptores finales de electrones de compuestos orgánicos. Aunque  el rendimiento de 545 kcals/mol de glucosa obtenidos a partir de la reacción con glucosa hasta reducirlo a óxido nitroso, no tiene la misma ventaja energética de la glucosa oxidada aeróbicamente que produce 686 kcals por mol de glucosa. 
Los microorganismos fijadores de nitrógeno se pueden dividir en dos grandes grupos: los que viven libremente y los que viven en asociación simbiótica con plantas. Azotobacter es una especie de bacterias que suministra el nitrógeno fijado en el césped de los jardines, donde no hay simbiontes fijadores de nitrógeno. Se cree que la tasa de fijación de nitrógeno oscila entre 3-6 kg por hectárea por año. Para el planeta Tierra en general, se considera que la mayor fuente natural de nitrógeno fijado son las legumbres. El ingreso de nitrógeno en la alfalfa puede llegar a 350 kg por hectárea, casi 100 veces la tasa de fijación de nitrógeno por un microorganismo no simbionte.

[1] Kobayashi T, Kurane R, Nakajima K, Nakamura Y, Kirimura K, et al: Isolation of bacteria degrading carbazole under microaerobic conditions, i.e. nitrogen gas substituted conditions Biosci Biotechnol Biochem. 1995 May; 59(5): 932-3

Rango de sustancias orgánicas para el crecimiento

El enorme poder catalítico de los microorganismos contribuye a muchas de las transformaciones químicas que ocurren en la superficie del planeta Tierra. A causa de su tamaño pequeño muchas bacterias y hongos poseen una gran proporción de superficie:volumen que permite mayor rapidez en el intercambio de sustancias, en comparación con los animales y las plantas. Las tasas respiratorias de algunas bacterias aeróbicas superan ampliamente a la de los animales.

La capacidad de los microorganismos de catabolizar una gran variedad de compuestos orgánico ha hecho surgir el concepto de la infalibilidad bacteriana. Pero hay sustancias que no son necesariamente digeridas por el metabolismno bacteriano, una de ellas es el humus de los suelos, la sustancia responsable del color café del suelo, y parece provenir de la degradacion parcial de la lignina. La estabilidad del humus es tal, que por datación con radiocarbono se ha demostrado que puede llegar a tener hasta milenios de antigüedad. La versatilidad del mundo microorgánico no es un reflejo de la versatilidad metabólica de sus miembros en forma individual. Sin embargo, la existencia de bacterias autotróficas en la naturaleza, responsables de la oxidación de compuestos inorgánicos reducidos ya presentes en la naturaleza, es de alta especificidad. Cada tipo de autótrofo es capaz de oxidar en general tan solo una clase de compuestos inorgánicos y en el caso particular de las bacterias nitrificantes, solamente un compuesto [1].


[1] Chapter 25. Microorganisms as geochemical agents. En: Stanier RY, Adelberg EA, Ingraham JL: General Microbiology. 4th Edition. Macmillan Publishers 1985. pp 714-717

Tipos de condiciones ambientales que permiten el crecimiento y la supervivencia bacteriana

Altas y bajas temperaturas

Thomas O. Brock, un microbiólogo de la universidad de Indiana  inició en 1966 sus descripciones y estudios sobre las bacterias que crecían en temperaturas excesivamente altas (hasta de 70ºC), no imagino lo lejos que llegarían sus aportes en el desarrollo de la biotecnología del tiempo actual. Uno de los muchas bacterias termófilas recolectadas por Brock en Yellowstone fué Thermus aquaticus. A mediados de los 80s se desató una oleada de interés por los termófilos por el desarrollo de la reacción en cadena de polimerasa. Uno de los pasos claves en el proceso de la PCR es la alta temperatura en la separación de las dos hebras de la molécula de ADN, que inactivaba  la enzima deE. coli que controlaba la replicación. De modo que la polimerasa de ADN de Thermus aquaticuscomenzó a ser empleada en la reacción. Los extremófilos, como también se conoce a  las bacterias termófilas pertenecen a las arquibacterias. Se desarrollaron investigaciones sobre la enzimología de los termófilos encontrando la presencia de tres enzimas importantes en el metabolismo de los termófilos que crecen en rangos de temperatura entre los 55 y 100ºC. Tales enzimas incluyen la citrato sintetasa, la glucosa deshidrogenasa y la lipoamina deshidrogenasa. Se ha encontrado que una enzima de Pyrococcus furiosus es aún más estable al calor que la polimerasa de ADN deThermus aquaticus. Se están desarrollando proyectos investigativos adicionales en los que por ejemplo, los patrones enzimáticos para la calibración de mediciones de aminotransferasa de aspartato (ALT/TGO) y de aminotransferasa de alanina (ALT/TGP) son enzimas provenientes deThermus aquaticus o de Bacillus stearothermophilus que ofrecen mayor estabilidad a altas temperaturas en comparación con las enzimas porcinas tradicionalmente usadas [1].

Tolerancia al estrés térmico

La interpretación sobre la función de las proteínas de estrés térmico es un tanto complicada por la razón que ellas también tienen un papel en condiciones fisiológicas así como durante períodos de estrés térmico. La cinética de la inducción a termotolerancia bajo diferentes condiciones, depende de la cinética de la síntesis de proteínas de estrés térmico y alcanza un máximo cuando la acumulación de las proteínas de estrés térmico llega a un valor de meseta. Del mismo modo, la extinción de la termotolerancia coincide con la degradación de las proteínas de estrés térmico. Del mismo modo, en aquellos estadíos del desarrollo en los cuales las proteínas de estrés térmico no son inducibles, hay termosensibilidad [2].
La respuesta a estrés térmico conlleva un aumento en la transcripción de los genes codificadores de las proteínas de estrés térmico, que implica una conexión entre el medio ambiente y el aparato genético. Una de las proteínas a las que se ha atribuído un papel en la comunicación entre los cambios de temperatura ambiental y las adaptaciones concomitantes del aparato genético, es la proteína ligada a la ubiquitina. En la célula eucariótica la ubiquitina es un sistema no lisosómico dependiente de ATP que se encarga entre otras, de la degradación de polipéptidos. La ubiquitina es una proteína ubicua, presente desde los mohos hasta Homo sapiens sapiens (células eucarióticas). La ubiquitina es activada por ATP en el residuo de glicina carboxiterminal, seguida por una serie de reacciones enzimáticas que culminan en la adherencia de la ubiquitina a los residuos epsilón-lisina de las proteínas. Las proteínas poliubiquitinadas se vuelven blancos fáciles para la digestión por proteasas. En Escherichia coli el gen lon codifica una proteasa dependiente de ATP. Esta proteasa codificada por el gen lon es parte del sistema de detección celular para estrés térmico y activa las proteínas que a su vez activan los genes de la respuesta a estrés térmico.
Los microorganismos pueden encontrar gran fluctuación de temperaturas en sus medios ambientes, por ejemplo Escherichia coli se puede encontrar en ambientes de 37ºC en el intestino de mamíferos y se puede encontrar también en ambientes de hasta -20ºC en aguas residuales. Los microorganismos que se enfrentan a cambios de hábitat tan extremos necesariamente deben producir proteínas de estrés térmico, sobre todo cuando se encuentran en ambientes con temperaturas elevadas [3].

[1] Edelson E: Thermophiles go to extremes. Helix. Amgen’s Magazin of Biotechnology 1993; 2(3): 18-19 [2]Lindquist S: The heat-shock response. Ann Rev Biochem 1986; 55: 1180 [3] Schlesinger MJ: Heat-shock proteins: the search for functions. J Cell Biol 1986; 103:321-325

Regulación de la respuesta de estrés térmico

Una característica sorprendente de la respuesta a estrés térmico es que es controlada al nivel de transcripción, según evidencias experimentales de varios organismos. Las secuencias promotoras de varios genes de estrés térmico revelan dos elementos de consenso en las regiones -35 y -10: TNtCNCcCTTGAA y CCCCATtT.

Promotores procarióticos en E. coli

GroE               TT       TCCCCCTTGAAGGGGCGAAGCCAT      CCCCATTTCTCTGGTCAC

dnaK P1          TC       TCCCCCTTGATGACGTCCTTTACGA      CCCCATTTGTAGTCAA

dnaK P2          TTGGGCAGTTGAACCAGACGTTTCG                CCCCTATTACAGACTCAC

rpoD PHS       TGC    CACCCTTGAAAAACTGTCGATGTGGGACGATATAGCAGATA

lon                   TCTCGGCGTTGAATGTGGGGGAAACAT           CCCCATATACTGACGTAC

secuencia de consenso: T         tC        CcCTTGAA    (13-15 bp)       CCCCATttA

El factor activante de transcripción que opera en las secuencias nucleotídicas de consenso codifica una  proteína de 33 kDa que presenta homologías con la subunidad sigma polimerasa, aunque es la mitad de esta proteína. El gene que codifica la proteína sigma es el rpoH. La concentración de ARNm trascriptor para sigma es aumentada por el estrés térmico. Sin embargo, esto no es claro porque rpoHno posee la secuencia nucleotídica de consenso promotor de proteínas de estrés térmico. La proteína sigma normalmente tiene una vida media en el rango de minutos, pero se prolonga cuando hay mutaciones en el gen dnaK [1].


[1] Lindquist S: The heat-shock response. Ann Rev Biochem 1986; 55: 1176

Humedad

Tolerancia a la desecación de las células procarióticas

La remoción del agua ligada a la pared por secamiento al aire y la adición de agua a estas células secadas por el aire fueron estímulos evolutivos para las células procarióticas. En las células bacterianas que han sido sometidas a secamiento por aire, la evaporación del agua citoplasmática libre es instantánea de modo que la célula debe obtener un rapido equilibrio entre el agua ligada celularmente y la presión de vapor agua atmosférico. En respuesta a la desecación algunas bacterias mueren, mientras otras pueden tolerar la desecación por largos períodos de tiempo. Estas son las llamadas células anhidrobióticas, que se caracterizan por requerir contenidos de agua tan bajos como 0.02 gramos de agua por gramo de peso seco. Con estos niveles de humedad, la hemicapa exoplásmica de la pared celular no tiene mayor recubrimiento de agua, así como tampoco otras macromoléculas como ADN o proteínas. La tolerancia a la desecación refleja una compleja disposición a nivel estructural, fisiológico y molecular. Aunque muchos de los mecanismos no están completamente revelados, se conoce que existen interacciones entre proteínas y co-solventes con propiedades semejantes a las de la molécula de agua. La hipótesis llamada de “reemplazo de agua” explica como los disacáridos no reductores trehalosa y sucrosa preservan la integridad de las membranas y proteínas. Sin embargo, es poco lo que se conoce del citoplasma de una célula procariótica desecada.
Entre las células procarióticas anhidrobióticas destacan las cianobacterias, como Nostoc commune, la cual parece englobar una serie de características críticas para la comprensión del comportamiento a largo plazo de un medio anhidrobiótico. Entre tales características, destacan la elaboración de un glicano extracelular, una gran síntesis de pigmentos neutralizantes de radiación UV y el mantenimiento de la estabilidad de proteínas y la integridad estructural [1].

[1] Potts M: Desiccation tolerance of prokaryotes. Microbiol Rev 1994; 58(4):755 – 805

Rol de Oxígeno

La vida multicelular diferenciada comenzó una vez el oxígeno libre apareció en la atmósfera.  La evolución de formas de vida superiores no habría sido posible sin los altos niveles de liberación de energía que libera el metabolismo oxidativo. La subsecuente evolución de las formas de vida en presencia de oxígeno fué posible merced a la creación y/o existencia de sistemas de tipo protector contra el oxígeno molecular ordinario, el ozono y el oxígeno atómico (O,O3 , O ). El oxígeno y su consecuencia metabólica, el metabolismo oxidativo, hicieron posible la obtención de una mayor cantidad de energía: frente a las 50 kcal/mol obtenidas de un mol de glucosa por fermentación, el metabolismo oxidativo permite la obtención de 686 kcal/mol. El rol dinámico del oxígeno es la aceptación de hidrogeniones en las oxidaciones biológicas.
Históricamente, Pasteur describió el metabolismo de tipo fermentativo en el género Clostridium en el siglo XIX. Entre sus principales hallazgos, estuvo el de la síntesis de ácido butírico y la fermentación de azúcares.
La oxidación biológica de las moléculas orgánicas inicia por procesos de deshidrogenación: las enzimas remueven átomos de hidrógeno de una molécula dada y los transfiere a moléculas especializadas que funcionan como portadores de hidrogeniones. Cuando estos portadores se saturan, se suspende el proceso de oxidación hasta que un aceptor este disponible. Por ejemplo, en el proceso de fermentación anaeróbica algunas moléculas orgánicas funcionan como los aceptores o portadores de hidrogeniones. La fermentación produce entonces la oxidación de algunos elementos orgánicos junto con reducción simultánea de algunos otros. En la fermentación de la glucosa, parte de la glucosa es oxidada a CO2 y otra parte es reducida a etanol.
El papel del oxígeno es semejante a un “vertedero” de electrones, o el de un aceptor de hidrogeniones en las reacciones de oxidación biológica. Las mayores fuentes no vivientes de oxígeno son el CO2, el agua y el O2    molecular; en la medida que tales moléculas intercambian átomos de oxígeno, se pueden considerar como un reservorio común. Los óxidos minerales más comunes tales como los formados con los iones de nitrato y sulfato son igualmente fuentes de oxígeno para los organismos vivientes, los cuales en su proceso metabólico los reducen a amonio (NH3) y ácido sulfhídrico (H2S). Estas moléculas al ser ulteriormente re-oxidadas intercambian sus átomos con agua. La oxidación biológica de las moléculas orgánicas se inicia por un proceso de deshidrogenación. Las enzimas deshidrogenasas toman los hidrogeniones y los transfieren a moléculas portadoras.
En el proceso de respiración aeróbica el oxígeno sirve como el aceptor de hidrogeniones, resultando de esto la producción de agua. La transferencia de los átomos de hidrógeno al oxígeno (lo cual equivale a decir transferencia de electrones) es canalizada a través de una cadena de catalizadores y cofactores [1]. Dentro de los cofactores destacan los pigmentos conteniendo hierro llamados citocromos, los cuales son de varias clases y pueden variar en su afinidad por electrones. Esta diferencia en las afinidades por los electrones por parte de esta cadena de cofactores que transfieren los electrones origina el concepto de potencial redox (o de oxidación/reducción) de una molécula.
Si el potencial redox es más positivo, es mayor la afinidad de la molécula oxidada por los electrones. Por ejemplo, el potencial redox del citocromo b es de 0.12 volt, el del citocromo c es de 0.22 volt, el del citocromo a es de 0.29 volt. El potencial redox del oxígeno para ser reducido a agua es de 0.8 volt. El pasaje sucesivo de electrones a través de la cadena de citocromos disminuye el gradiente del potencial. La secuencia de oxidaciones y reducciones sucesivas a lo largo de la cadena es la siguiente:

 e         citocromo b                 citocromo c                 citocromo a                 oxígeno

            0.12 volt                      0.22 volt                      0.29 volt                      0.8 volt

La energía liberada en estas reacciones de oxidación/reducción es acoplada con la síntesis de fosfatos de alta energía, básicamente el ATP. La enzima citocromo-oxidasa contiene cobre, el cual media la transferencia desde el citocromo a hasta el oxígeno. En las células de los organismos superiores el sistema oxidativo de enzimas y los transportadores de electrones se encuentran en las mitocondrias. Estos organelos se pueden asemejar a efectivos hornos de baja temperatura donde las moléculas entran en combustión con el oxígeno. La mayoría de la energía liberada se acumula en los enlaces de alta energía del ATP.
El oxígeno molecular reacciona espontáneamente con los compuestos orgánicos y otras moléculas reducidas. Este alto grado de reactividad explica los efectos tóxicos del oxígeno en concentraciones superiores a las normales. El oxígeno no es toxico para las células superiores debido a la existencia de las estructuras llamadas peroxisomas, las cuales contienen enzimas que producen la reducción directa de las moléculas de oxígeno a través de la oxidación de aminoácidos y otros ácidos orgánicos. Uno de los productos de la oxidación de los peroxisomas es el peróxido de hidrógeno, producido por la superóxido dismutasa (H2O2). Otra enzima de los peroxisomas, la catalasa, emplea el peróxido de hidrógeno como aceptor de hidrogeniones en la oxidación de substratos como el etanol o el ácido láctico. En la medida de mayores concentraciones de oxígeno los peroxisomas aumentan su actividad enzimática. La diferencia básica entre la oxidación a nivel mitocondrial y la oxidación en los peroxisomas, es que en estos últimos, los pasos de oxidación no están acoplados con la producción de enlaces fosfato de alta energía. La energía liberada en los peroxisomas se pierde para la célula, ya que la función primaria del organelo es proteger contra los destructivos efectos de la reactividad del oxígeno.
El oxígeno disuelto en el agua puede difundir a través de las membranas celulares y tal suplencia es adecuada para pequeñas colonias de microorganismos.
La atmósfera terrestre tuvo un origen secundario a partir de la actividad volcánica del interior del planeta. Sin embargo, el oxígeno no es uno de los gases liberados. El advenimiento de una atmósfera con mayores concentraciones de oxígeno obligó a que los primeros organismos celulares de tipo heterótrofo (cuyo metabolismo dependía de fuentes energéticas externas) tuvieran una sucesiva transformación hasta originar los autótrofos. Podría ser posible que estos primeros organismos -llamados eobiontes- además de autótrofos antes de ser aeróbicos primero fueron de naturaleza anaeróbica.

Género Clostridium

Existen alrededor de 60 especies de clostridios con una gran diversidad de mecanismos de metabolismo que en general han sido la base para la clasificación de las diversas especies.
Muchos clostridios fermentan carbohidratos solubles como almidón o pectina con la formación de ácidos acético y butírico, dióxido de carbono y agua. A partir del butirato se les ha denominado bacterias de ácido butírico, caracterizadas por su escaso crecimiento en medios de cultivo en los que falten carbohidratos para fermentar, por la síntesis de material de reserva consistente en un polisacárido amiloideo que confiere un color púrpura en células tratadas con tintura de yodo; y por último, por una activa fijación de nitrógeno, una propiedad ausente en otras especies de clostridios.
La fermentación butírica es iniciada por la conversión de los azúcares hasta piruvato a través de la vía metabólica de Embden-Meyerhoff. El piruvato se cliva en Acetil-CoA, CO2  y H2. A partir del Acetil-CoA surge acetato, concomitantemente con ATP. A partir de la fusión de dos moléculas de acetil-CoA surge el ácido butírico.
Adicionalmente algunas de las bacterias butíricas producen acetona, butanol, isopropanol,  y etanol a partir de azúcares. El etanol se forma a partir de la reducción del acetil-CoA. Estos alcoholes surgen por disminución en las cantidades de butirato e hidrógeno sintetizados. Su producción implica la reutilización del hidrógeno producido el cual sirve como reductor del NAD+. El mantenimiento de altas presiones parciales de hidrógeno en los cultivos produce una fermentación conocida como la de acetona-butanol. Esta identifica a la especie de Clostridium acetobutylicum  y ha sido empleada a gran escala para la producción de acetona y butanol, dos solventes industriales. Otras aplicaciones industriales han surgido indirectamente debido a que el medio empleado para el crecimiento deClostridium acetobutylicum es también favorable para el crecimiento de lactobacilos, de gran utilidad en la industria láctea. Los lactobacilos inhiben el desarrollo ulterior de los clostridios por la formación de ácido láctico [2].

[1] Un catalizador se define como “una sustancia que disminuye la energía de activacionde una reacción química formando una asociación temporal con las moléculas reactivas, dando como resultado que la tasa de la reacción se acelere. Las enzimas son catalizadores. Un cofactor es un componente no proteínico que desempeña un papel accesorio en los procesos catalizados por enzimas: algunos cofactores son iones y otros son coenzimas. Una coenzima es una molécula orgánica no proteínica que desempeña un papel accesorio en las reacciones catalizadas por enzimas y frecuentemente actúan como dador o aceptor de electrones de una sustancia que interviene en la reacción. NAD+, FAD+y coenzima-A son coenzimas comunes. Una enzima es una molécula de proteína globular que acelera una reacción química específica. [2] Chapter 22. Gram-positive bacteria. En: Stanier RY, Adelberg EA, Ingraham JL: General Microbiology. 4th Edition. Macmillan Publishers 1985. pp 652-654

Ambientes nutricionalmente pobres

En las aguas oceánicas existe deficiencia de hierro, el cual cuando está presente, existe como hidróxido férrico el cual puede ser usado si los microorganismos lo fijan a su pared celular. Existen ambientes nutricionalmente pobres en un rango intermedio, como en el suelo terrestre en una región húmeda, o una zona costera en las cuales el fósforo probablemente sea el elemento limitante. El fósforo es de particular importancia porque no solamente es un elemento vital para los microorganismos, sino que es también relativamente escaso, si se lo compara con sus vecinos de tabla periódica, a saber el silicio y el azufre. Sin embargo, cuando existe una mayor concentración de fósforo, aumenta la cantidad de nitrógeno fijado biológicamente: las proporciones de P/Ntenderán a permanecer homogéneas con las existentes en el medio ambiente y ambos elementos tenderán a volverse limitantes. 

Recursos en la web

Revolución Darwin. El Legado Intelectual de Darwin en el siglo XXI (Lunes 7 de septiembre)http://www.mundovision.cl/webinar2.php?id=534

Sobre el autor


Simple Clock

Responder

Introduce tus datos o haz clic en un icono para iniciar sesión:

Logo de WordPress.com

Estás comentando usando tu cuenta de WordPress.com. Cerrar sesión / Cambiar )

Imagen de Twitter

Estás comentando usando tu cuenta de Twitter. Cerrar sesión / Cambiar )

Foto de Facebook

Estás comentando usando tu cuenta de Facebook. Cerrar sesión / Cambiar )

Google+ photo

Estás comentando usando tu cuenta de Google+. Cerrar sesión / Cambiar )

Conectando a %s

A %d blogueros les gusta esto: